One of the 2012 top innovations, says The Scientist, is the new NanoLuc luciferase reporter. But what is NanoLuc exactly and what's really innovative?
When I read Vicky Chandler on my free copy of The Scientist that NanoLuc was a 2012 innovation, I didn't know what she was talking about. I knew that firefly luciferase has some limitations, so I started collecting information to evaluate if I should start making my new plasmids with this improved NLuc luciferase. In this post, I collect the information obtained for future reference.
What is NanoLuc?
NanoLuc (NLuc) is a 19.1 kDa luciferase derived by Lance P. Encell and collaborators using as starting template the luciferase cDNA from a deep sea shrimp that was previously cloned and patented by Chisso corporation. Compared to the wild-type Oplophorus gracilirostris luciferase, NLuc protein received at least three rounds of mutagenesis to optimize luminescence, stability and interaction with the substrate. The DNA of the optimized protein went also through codon optimization for expression in mammallian cells. In addition, potentially strong mRNA secondary structures, transcription factor binding sites and potential splice sites have been replaced with alternative codons, like other commercial luciferases. The peer-reviewd publication describing the engineering of NanoLuc was published by Mary P. Hall et al. on ACS Chemical Biology the August 15, 2012.
What is NanoLuc sequence?
The full NanoLuc sequence can be obtained from Promega site. The fasta NanoLuc sequence is:
>Nluc
What is NanoLuc sequence?
The full NanoLuc sequence can be obtained from Promega site. The fasta NanoLuc sequence is:
>Nluc
ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTG
GACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTA
ACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTC
ATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAG
GTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTA
ATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCC
GTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATC
GACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACGGAGTG
ACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAA
Who sells Nanoluc?
Promega. The DNA plasmid containing the NanoLuc gene runs about $320. Plasmid variants include a PEST-destabilized NLuc which gives better kinetic responses and a secreted NLuc for those preferring to measure luciferase activity in the cell media. The substrate used to detect the molecule's glow on a classic luminometer is another $125, according to Kevin Kopish, global product manager for NanoLuc.
Can't I use the luciferin stock I have obtained for my old Firefly?
No. Bioluminescence evolved several times in different animals. In presence of ATP, fireflies oxidize D-luciferin to emit light. Conversely, marine luciferases like Renilla and Gaussia utilize coelenterazine and requires O2 (but no ATP). NanoLuc originates from a marine shrimp and can use coelenterazine. However, coelenterazine sucks so, during NanoLuc engineering, 24 novel coelenterazine analogues were screened to give more luminescence and less autoluminescence (to minimize background). The chemical stability was also increased because coelenterazine is not very stable in culture media (half-life < 1h). The best identified substrate, Furimazine 50 uM, is 30-fold more bright then coelenterazine 10 uM according to Table 1 of the ACS publication and its chemical half-life is > 4h. However, the different concentrations makes a difficult comparison, and furimazine does not work very well with Renilla.
How does NanoLuc compare vs Firefly and Renilla?
- Size. NLuc has the shortest gene (513 bp) that is close to Gaussia (Gluc, 555 bp) while Renilla and Firefly are longer (Rluc 936 bp, Fluc 1650 bp). The small size is a clear advantage for cloning, for instance one can save space when making lentiviruses or adenoviruses for reporter gene transduction. If the designed construct requires lot of clone editing, having a reporter 1/3 the firefly luciferase, gene synthesis services may be an interesting option, see my advice with piranha gene synthesis companies. A reporter is supposed to report and not to alter the cellular functions. There is a general belief to consider a smaller protein less capable of interfering with the cellular machinery. This is just bullshit as some of the more poisonus snake venoms are peptides of few amino acids. However with protein-reporter fusions, a smal reporter will be less able to alter the protein conformation/mobility at least because of smaller steric/buoyant forces.
- Brightness. Purified Nluc seems ~150-fold more luminescent than either Fluc or Rluc on a per mole basis and under glow conditions that is when luciferase and substrate are mixed and equilibrated for a while. Under these conditions, at least two factors affect luminescence: the luciferase stability and the quantum yield. If the luciferase is stable, in the assay chamber few luciferase proteins will broke so there will be more light-emitting proteins. For a single luciferase protein, the quantum yield is the number of photons emitted for a single substrate reaction. NLuc quantum yield is not known but Firefly and Renilla luciferases have already quite high quantum yield (0.1 Renilla, 0.4 Firefly), so much of Nanoluc luminescence is likely attributable to its stability. In cicloheximide experiments, Nanoluc half-life is more than 6h, Firefly is around 2 hours.
- Spectral profile. Like other marine luciferases, NLuc emits in the blue region, with an emission maximum of 460 nm. Both Renilla and Gaussia maximum is around 480 nm. Firefly maximum is around 578 nm with an additional 34 nm red shift at 37 °C.
The comparison Nluc vs Gaussia has not been reported so far. Being sold from different vendors, we have to wait for an independent study.
Can I make NLuc transgenes for use with in vivo bioluminescence imaging (BLI)?
I suggest no. Technically it is feasible, and having a shorter gene facilitates knock-in procedures. However, the blue light typical of marine luciferases like Nluc do not pass through internal tissues and is absorbed by hemo-proteins, so most of the signal will be not detected by the CCD camera. The substrate also has some shortcomings for in vivo imaging: coelenterazine is rapidly degraded in vivo and need to be administered with tail-vein injections. In vivo data of furimazine stability and toxicity are still missing. Firefly and red-shifted firefly luciferases are still the more sensitive choice, and their substrate D-luciferin can be easily administered with i.p. injections.
I suggest no. Technically it is feasible, and having a shorter gene facilitates knock-in procedures. However, the blue light typical of marine luciferases like Nluc do not pass through internal tissues and is absorbed by hemo-proteins, so most of the signal will be not detected by the CCD camera. The substrate also has some shortcomings for in vivo imaging: coelenterazine is rapidly degraded in vivo and need to be administered with tail-vein injections. In vivo data of furimazine stability and toxicity are still missing. Firefly and red-shifted firefly luciferases are still the more sensitive choice, and their substrate D-luciferin can be easily administered with i.p. injections.
Is Nluc viable for protein-protein fusions?
Yes, the article (available for free) showcases several examples. Nluc seems also an interesting partner for bioluminescence resonance energy transfer (BRET).
Will you use Nanoluc?
My main scientific interest is understanding the kinetics of nutritional cues on gene expression and use these space-temporal profiles to help the design of safer therapies. Being so focused on temporal aspects, a very stable reporter is not my best choice. Nluc-PEST (destabilized, half-life around 2 hrs) is available. I'm obviously curious to see how the dynamics of my reporter plasmids would change with Nluc, but this is not my first priority at the moment. However, I find Nluc a very appealing reporter.
Yes, the article (available for free) showcases several examples. Nluc seems also an interesting partner for bioluminescence resonance energy transfer (BRET).
Will you use Nanoluc?
My main scientific interest is understanding the kinetics of nutritional cues on gene expression and use these space-temporal profiles to help the design of safer therapies. Being so focused on temporal aspects, a very stable reporter is not my best choice. Nluc-PEST (destabilized, half-life around 2 hrs) is available. I'm obviously curious to see how the dynamics of my reporter plasmids would change with Nluc, but this is not my first priority at the moment. However, I find Nluc a very appealing reporter.
What does the Oplophorus shrimp use luciferase for?
When treatened, this deep sea prawn spit a cloud of luciferase-containing material that distracts and blinks potential predators. Beware: some graduate student using NanoLuc may acquire similar behaviour when the PI is in proximity.
