Human Adenosine A2a Receptor (ADORA2a) ELISA Kit

DLR-ADORA2a-Hu-96T 96T
EUR 673
  • Should the Human Adenosine A2a Receptor (ADORA2a) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine A2a Receptor (ADORA2a) in samples from tissue homogenates or other biological fluids.

Human Adenosine A2a Receptor (ADORA2a) ELISA Kit

RD-ADORA2a-Hu-48Tests 48 Tests
EUR 521

Human Adenosine A2a Receptor (ADORA2a) ELISA Kit

RD-ADORA2a-Hu-96Tests 96 Tests
EUR 723

Human Adenosine A2a Receptor (ADORA2a) ELISA Kit

RDR-ADORA2a-Hu-48Tests 48 Tests
EUR 544

Human Adenosine A2a Receptor (ADORA2a) ELISA Kit

RDR-ADORA2a-Hu-96Tests 96 Tests
EUR 756

Adora2a/ Rat Adora2a ELISA Kit

ELI-12131r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADORA2A antibody

70R-30678 100 ug
EUR 327
Description: Rabbit polyclonal ADORA2A antibody

ADORA2A antibody

70R-9944 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ADORA2A antibody

ADORA2A antibody

70R-9945 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ADORA2A antibody

ADORA2A antibody

70R-31415 100 ug
EUR 327
Description: Rabbit polyclonal ADORA2A antibody

ADORA2A Antibody

ABD4850 100 ug
EUR 438

ADORA2A Antibody

ABD4906 100 ug
EUR 438

ADORA2A Antibody

ABD6482 100 ug
EUR 438

ADORA2A antibody

38260-100ul 100ul
EUR 252

ADORA2A Antibody

39487-100ul 100ul
EUR 390

ADORA2A Antibody

DF4850 200ul
EUR 304
Description: ADORA2A Antibody detects endogenous levels of total ADORA2A.

ADORA2A Antibody

DF4906 200ul
EUR 304
Description: ADORA2A Antibody detects endogenous levels of total ADORA2A.

ADORA2A Antibody

DF6482 200ul
EUR 304
Description: ADORA2A Antibody detects endogenous levels of total ADORA2A.

ADORA2A Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ADORA2A Antibody

CSB-PA001376KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ADORA2A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ADORA2A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

ADORA2A Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

ADORA2A Conjugated Antibody

C38260 100ul
EUR 397

ADORA2A Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ADORA2A Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ADORA2A Rabbit pAb

A1587-100ul 100 ul
EUR 308

ADORA2A Rabbit pAb

A1587-200ul 200 ul
EUR 459

ADORA2A Rabbit pAb

A1587-20ul 20 ul
EUR 183

ADORA2A Rabbit pAb

A1587-50ul 50 ul
EUR 223

ADORA2A Blocking Peptide

33R-5963 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADORA2A antibody, catalog no. 70R-9945

ADORA2A Blocking Peptide

33R-8416 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADORA2A antibody, catalog no. 70R-9944

ADORA2A Blocking Peptide

DF4850-BP 1mg
EUR 195

ADORA2A Blocking Peptide

DF4906-BP 1mg
EUR 195

ADORA2A Blocking Peptide

DF6482-BP 1mg
EUR 195

ADORA2A cloning plasmid

CSB-CL001376HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1239
  • Sequence: atgcccatcatgggctcctcggtgtacatcacggtggagctggccattgctgtgctggccatcctgggcaatgtgctggtgtgctgggccgtgtggctcaacagcaacctgcagaacgtcaccaactactttgtggtgtcactggcggcggccgacatcgcagtgggtgtgctcg
  • Show more
Description: A cloning plasmid for the ADORA2A gene.


PVT13799 2 ug
EUR 391

Anti-ADORA2A antibody

STJ22527 100 µl
EUR 277
Description: This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding.

Rat ADORA2A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E12274h 96 Tests
EUR 824


ELI-24641d 96 Tests
EUR 928


EF004647 96 Tests
EUR 689

Human ADORA2A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ADORA2A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADORA2A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADORA2A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADORA2A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADORA2A. Recognizes ADORA2A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA