ARFGAP3

ARFGAP3 Antibody

1-CSB-PA885676ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ARFGAP3. Recognizes ARFGAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

ARFGAP3 Antibody

1-CSB-PA008739
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARFGAP3. Recognizes ARFGAP3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

ARFGAP3 antibody

70R-34004 100 ug
EUR 327.00
Description: Rabbit polyclonal ARFGAP3 antibody

ARFGAP3 Antibody

ABD3748 100 ug
EUR 438.00

ARFGAP3 Antibody

34393-100ul 100ul
EUR 252.00

ARFGAP3 Antibody

34393-50ul 50ul
EUR 187.00

ARFGAP3 antibody

70R-10382 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal ARFGAP3 antibody

ARFGAP3 antibody

70R-15794 50 ul
EUR 435.00
Description: Rabbit polyclonal ARFGAP3 antibody

ARFGAP3 siRNA

20-abx900407
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARFGAP3 siRNA

20-abx907937
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARFGAP3 siRNA

20-abx907938
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARFGAP3 Antibody

1-CSB-PA001999GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ARFGAP3. Recognizes ARFGAP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARFGAP3 Antibody

CSB-PA189802-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARFGAP3. Recognizes ARFGAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARFGAP3 Antibody

CSB-PA189802-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ARFGAP3. Recognizes ARFGAP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARFGAP3 Antibody

DF3748 200ul
EUR 304.00
Description: ARFGAP3 Antibody detects endogenous levels of total ARFGAP3.

ARFGAP3 Conjugated Antibody

C34393 100ul
EUR 397.00

Anti-ArfGAP3 Antibody

A06839 100uL
EUR 455.00
Description: Rabbit Polyclonal ArfGAP3 Antibody. Validated in IP, IF, WB and tested in Human.

ARFGAP3 cloning plasmid

CSB-CL885676HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1551
  • Sequence: atgggggaccccagcaagcaggacatcttgaccatcttcaagcgcctccgctcggtgcccactaacaaggtgtgttttgattgtggtgccaaaaatcccagctgggcaagcataacctatggagtgttcctttgcattgattgctcagggtcccaccggtcacttggtgttcact
  • Show more
Description: A cloning plasmid for the ARFGAP3 gene.

ARFGAP3 Blocking Peptide

33R-10325 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARFGAP3 antibody, catalog no. 70R-10382

Anti-ARFGAP3 antibody

PAab00538 100 ug
EUR 355.00

pCMV-SPORT6-ARFGAP3

PVT12422 2 ug
EUR 391.00

anti- ARFGAP3 antibody

FNab00538 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: ADP-ribosylation factor GTPase activating protein 3
  • Uniprot ID: Q9NP61
  • Gene ID: 26286
  • Research Area: Signal Transduction
Description: Antibody raised against ARFGAP3

ARFGAP3 Rabbit pAb

A8204-100ul 100 ul
EUR 308.00

ARFGAP3 Rabbit pAb

A8204-200ul 200 ul
EUR 459.00

ARFGAP3 Rabbit pAb

A8204-20ul 20 ul
EUR 183.00

ARFGAP3 Rabbit pAb

A8204-50ul 50 ul
EUR 223.00

ARFGAP3 Blocking Peptide

DF3748-BP 1mg
EUR 195.00

Anti-ARFGAP3 antibody

STJ110503 100 µl
EUR 277.00
Description: The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene.

Anti-ARFGAP3 antibody

STJ70078 100 µg
EUR 359.00

Mouse ARFGAP3 shRNA Plasmid

20-abx975498
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ARFGAP3 shRNA Plasmid

20-abx991043
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ARFGAP3 shRNA Plasmid

20-abx958806
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARFGAP3 ELISA KIT|Human

EF007853 96 Tests
EUR 689.00

Human ARFGAP3 ELISA KIT

ELI-11650h 96 Tests
EUR 824.00

Mouse Arfgap3 ELISA KIT

ELI-49029m 96 Tests
EUR 865.00

Bovine ARFGAP3 ELISA KIT

ELI-49070b 96 Tests
EUR 928.00

ARFGAP3 Recombinant Protein (Rat)

RP190709 100 ug Ask for price

ARFGAP3 Recombinant Protein (Human)

RP001705 100 ug Ask for price

ARFGAP3 Recombinant Protein (Mouse)

RP116711 100 ug Ask for price

Arfgap3 ORF Vector (Mouse) (pORF)

ORF038905 1.0 ug DNA
EUR 506.00

ARFGAP3 ORF Vector (Human) (pORF)

ORF000569 1.0 ug DNA
EUR 95.00

Arfgap3 ORF Vector (Rat) (pORF)

ORF063571 1.0 ug DNA
EUR 506.00

Polyclonal Goat Anti-ARFGAP3 Antibody

APR16210G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ARFGAP3 . This antibody is tested and proven to work in the following applications:

Arfgap3 sgRNA CRISPR Lentivector set (Mouse)

K3450901 3 x 1.0 ug
EUR 339.00

ARFGAP3 sgRNA CRISPR Lentivector set (Human)

K0113301 3 x 1.0 ug
EUR 339.00

Arfgap3 sgRNA CRISPR Lentivector set (Rat)

K7501501 3 x 1.0 ug
EUR 339.00

Goat Anti Human Arfgap3 Polyclonal Antibody

CPBT-67848GH 0.1 mg
EUR 944.00

Polyclonal ARFGAP3 antibody - C-terminal region

APR14986G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARFGAP3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Arfgap3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3450902 1.0 ug DNA
EUR 154.00

Arfgap3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3450903 1.0 ug DNA
EUR 154.00