AURKB

Human Aurora Kinase B (AURKB) ELISA Kit

DL-AURKB-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Aurora Kinase B (AURKB)

Human Aurora Kinase B (AURKB) ELISA Kit

DL-AURKB-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Aurora Kinase B (AURKB)

Human Aurora Kinase B (AURKB) ELISA Kit

DLR-AURKB-Hu-48T 48T
EUR 517.00
  • Should the Human Aurora Kinase B (AURKB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aurora Kinase B (AURKB) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aurora Kinase B (AURKB) ELISA Kit

DLR-AURKB-Hu-96T 96T
EUR 673.00
  • Should the Human Aurora Kinase B (AURKB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aurora Kinase B (AURKB) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aurora Kinase B (AURKB) ELISA Kit

RD-AURKB-Hu-48Tests 48 Tests
EUR 521.00

Human Aurora Kinase B (AURKB) ELISA Kit

RD-AURKB-Hu-96Tests 96 Tests
EUR 723.00

Human Aurora Kinase B (AURKB) ELISA Kit

RDR-AURKB-Hu-48Tests 48 Tests
EUR 544.00

Human Aurora Kinase B (AURKB) ELISA Kit

RDR-AURKB-Hu-96Tests 96 Tests
EUR 756.00

Aurkb/ Rat Aurkb ELISA Kit

ELI-11427r 96 Tests
EUR 886.00

AURKB antibody

10R-1182 100 ul
EUR 316.00
Description: Mouse monoclonal AURKB antibody

AURKB antibody

10R-2091 100 ul
EUR 435.00
Description: Mouse monoclonal AURKB antibody

AURKB siRNA

20-abx900559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AURKB siRNA

20-abx908710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AURKB siRNA

20-abx908711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AURKB Antibody

1-CSB-PA000926
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

AURKB Antibody

1-CSB-PA000927
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

AURKB Antibody

1-CSB-PA002458EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Aurkb Protein

E20002 10 µg
EUR 499.50
Description: reagents widely cited

pOTB7-AURKB

PVT18404 2 ug
EUR 231.00

AURKB Antibody

BF0455 200ul
EUR 376.00
Description: AURKB antibody detects endogenous levels of total AURKB.

AurkB Polyclonal Antibody

27325-100ul 100ul
EUR 252.00

AurkB Polyclonal Antibody

27325-50ul 50ul
EUR 187.00

AURKB Polyclonal Antibody

A50073 100 µg
EUR 570.55
Description: The best epigenetics products

AURKB cloning plasmid

CSB-CL002458HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1035
  • Sequence: atggcccagaaggagaactcctacccctggccctacggccgacagacggctccatctggcctgagcaccctgccccagcgagtcctccggaaagagcctgtcaccccatctgcacttgtcctcatgagccgctccaatgtccagcccacagctgcccctggccagaaggtgatgg
  • Show more
Description: A cloning plasmid for the AURKB gene.

AURKB / AURKC Antibody

20-abx328932
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

AURKB/AURKC Antibody

1-CSB-PA000960
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AURKB/AURKC. Recognizes AURKB/AURKC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

AURKB Polyclonal Antibody

E-AB-30558-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey AURKB for WB,IHC-p,IF,ELISA applications.

AURKB Polyclonal Antibody

E-AB-30558-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey AURKB for WB,IHC-p,IF,ELISA applications.

AURKB Polyclonal Antibody

E-AB-30558-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat,Monkey AURKB for WB,IHC-p,IF,ELISA applications.

AURKB Polyclonal Antibody

E-AB-30559-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AURKB for WB,IHC-p,IF,ELISA applications.

AURKB Polyclonal Antibody

E-AB-30559-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AURKB for WB,IHC-p,IF,ELISA applications.

AURKB Polyclonal Antibody

E-AB-30559-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: May be directly involved in regulating the cleavage of polar spindle microtubules and is a k
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AURKB for WB,IHC-p,IF,ELISA applications.

anti-AURKB (13E8D3)

LF-MA30094 100 ul
EUR 537.00
Description: Mouse Monoclonal to AURKB

pOTB7-AURKB-2

PVT18860 2 ug
EUR 231.00

pOTB7-AURKB-3

PVT18861 2 ug
EUR 231.00

AurkB Rabbit pAb

A1020-100ul 100 ul
EUR 308.00

AurkB Rabbit pAb

A1020-200ul 200 ul
EUR 459.00

AurkB Rabbit pAb

A1020-20ul 20 ul
EUR 183.00

AurkB Rabbit pAb

A1020-50ul 50 ul
EUR 223.00

AURKB Blocking Peptide

BF0455-BP 1mg
EUR 195.00

Anti-AURKB antibody

STJ118003 100 µl
EUR 277.00

Anti-AURKB Antibody

STJ500192 100 µg
EUR 476.00

Rat AURKB shRNA Plasmid

20-abx987214
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AURKB shRNA Plasmid

20-abx972925
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AURKB shRNA Plasmid

20-abx956097
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AurkB Polyclonal Conjugated Antibody

C27325 100ul
EUR 397.00

AURKB Antibody, HRP conjugated

1-CSB-PA002458EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AURKB Antibody, FITC conjugated

1-CSB-PA002458EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AURKB Antibody, Biotin conjugated

1-CSB-PA002458ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AURKB. Recognizes AURKB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-AURKB (Y12) Antibody

1-CSB-PA070260
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-AURKB (Y12). Recognizes Phospho-AURKB (Y12) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000