B3GALNT2

B3GALNT2 antibody

70R-5327 50 ug
EUR 467.00
Description: Rabbit polyclonal B3GALNT2 antibody raised against the middle region of B3GALNT2

B3GALNT2 antibody

70R-5374 50 ug
EUR 467.00
Description: Rabbit polyclonal B3GALNT2 antibody raised against the middle region of B3GALNT2

B3GALNT2 antibody

70R-15943 50 ul
EUR 435.00
Description: Rabbit polyclonal B3GALNT2 antibody

B3GALNT2 siRNA

20-abx908754
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GALNT2 siRNA

20-abx908755
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B3GALNT2 Antibody

1-CSB-PA002489GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against B3GALNT2. Recognizes B3GALNT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

B3GALNT2 Conjugated Antibody

C46326 100ul
EUR 397.00

B3GALNT2 cloning plasmid

CSB-CL822760HU-10ug 10ug
EUR 531.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1503
  • Sequence: atgcgaaactggctggtgctgctgtgcccgtgtgtgctcggggccgcgctgcacctctggctgcggctgcgctccccgccgcccgcctgcgcctccggggccggccctgcagatcagttggccttatttcctcagtggaaatctactcactatgatgtggtagttggcgtgttgt
  • Show more
Description: A cloning plasmid for the B3GALNT2 gene.

B3GALNT2 Blocking Peptide

33R-3380 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of B3GALNT2 antibody, catalog no. 70R-5327

B3GALNT2 Blocking Peptide

33R-7062 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of B3GALNT2 antibody, catalog no. 70R-5374

Anti-B3GALNT2 antibody

PAab00763 100 ug
EUR 355.00

anti- B3GALNT2 antibody

FNab00763 100µg
EUR 505.25
  • Immunogen: beta-1,3-N-acetylgalactosaminyltransferase 2
  • Uniprot ID: Q8NCR0
  • Gene ID: 148789
  • Research Area: Metabolism
Description: Antibody raised against B3GALNT2

Mouse B3GALNT2 shRNA Plasmid

20-abx979342
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human B3GALNT2 shRNA Plasmid

20-abx965593
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

B3GALNT2 ELISA KIT|Human

EF008033 96 Tests
EUR 689.00

Human B3GALNT2 ELISA KIT

ELI-33387h 96 Tests
EUR 824.00

Mouse B3galnt2 ELISA KIT

ELI-34250m 96 Tests
EUR 865.00

B3GALNT2 Recombinant Protein (Rat)

RP191705 100 ug Ask for price

B3GALNT2 Recombinant Protein (Human)

RP002512 100 ug Ask for price

B3GALNT2 Recombinant Protein (Mouse)

RP118472 100 ug Ask for price

h B3GALNT2 inducible lentiviral particles

LVP098 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, B3GALNT2, is fully sequence verified and matched to NCBI accession ID: NM_152490.2

B3galnt2 ORF Vector (Mouse) (pORF)

ORF039492 1.0 ug DNA
EUR 506.00

B3GALNT2 ORF Vector (Human) (pORF)

ORF000838 1.0 ug DNA
EUR 95.00

B3galnt2 ORF Vector (Rat) (pORF)

ORF063903 1.0 ug DNA
EUR 506.00

B3galnt2 sgRNA CRISPR Lentivector set (Mouse)

K4852601 3 x 1.0 ug
EUR 339.00

B3GALNT2 sgRNA CRISPR Lentivector set (Human)

K0162701 3 x 1.0 ug
EUR 339.00

B3galnt2 sgRNA CRISPR Lentivector set (Rat)

K6390801 3 x 1.0 ug
EUR 339.00

Beta-1,3-N-Acetylgalactosaminyltransferase 2 (B3GALNT2) Antibody

abx036701-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Beta-1,3-N-Acetylgalactosaminyltransferase 2 (B3GALNT2) Antibody

20-abx111219
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

B3galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4852602 1.0 ug DNA
EUR 154.00

B3galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4852603 1.0 ug DNA
EUR 154.00

B3galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4852604 1.0 ug DNA
EUR 154.00

Beta-1,3-N-Acetylgalactosaminyltransferase 2 (B3GALNT2) Antibody

abx230763-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

B3GALNT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0162702 1.0 ug DNA
EUR 154.00

B3GALNT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0162703 1.0 ug DNA
EUR 154.00

B3GALNT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0162704 1.0 ug DNA
EUR 154.00

B3GALNT2 Protein Vector (Rat) (pPB-C-His)

PV255610 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Rat) (pPB-N-His)

PV255611 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Rat) (pPM-C-HA)

PV255612 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Rat) (pPM-C-His)

PV255613 500 ng
EUR 603.00

B3galnt2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6390802 1.0 ug DNA
EUR 154.00

B3galnt2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6390803 1.0 ug DNA
EUR 154.00

B3galnt2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6390804 1.0 ug DNA
EUR 154.00

B3GALNT2 Protein Vector (Mouse) (pPB-C-His)

PV157966 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Mouse) (pPB-N-His)

PV157967 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Mouse) (pPM-C-HA)

PV157968 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Mouse) (pPM-C-His)

PV157969 500 ng
EUR 603.00

B3GALNT2 Protein Vector (Human) (pPB-C-His)

PV003349 500 ng
EUR 329.00

B3GALNT2 Protein Vector (Human) (pPB-N-His)

PV003350 500 ng
EUR 329.00

B3GALNT2 Protein Vector (Human) (pPM-C-HA)

PV003351 500 ng
EUR 329.00