BIK siRNA
20-abx909106	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIK siRNA
20-abx909107	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIK Antibody
ABF6428	Lifescience Market	100 ug	EUR 438.00

BIK antibody
70R-51465	Fitzgerald	100 ul	EUR 287.00
Description: Purified Polyclonal BIK antibody

BIK antibody
70R-30646	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BIK antibody

BIK Antibody
ABD6958	Lifescience Market	100 ug	EUR 438.00

BIK Antibody
3703-100	Biovision		EUR 316.00

BIK Antibody
3703-30T	Biovision		EUR 146.00

BIK antibody
38406-100ul	SAB	100ul	EUR 252.00

Bik Antibody
24421-100ul	SAB	100ul	EUR 390.00

BIK antibody
70R-12017	Fitzgerald	100 ug	EUR 403.00
Description: Rabbit polyclonal BIK antibody

BIK Antibody
DF6958	Affbiotech	200ul	EUR 304.00
Description: BIK Antibody detects endogenous levels of total BIK.

BIK Antibody
1-CSB-PA003373	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIK. Recognizes BIK from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

BIK Antibody
1-CSB-PA615677ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIK. Recognizes BIK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BIK Blocking Peptide
AF6428-BP	Affbiotech	1mg	EUR 195.00

Polyclonal BIK Antibody
APR00174G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIK . This antibody is tested and proven to work in the following applications:

BIK Conjugated Antibody
C38406	SAB	100ul	EUR 397.00

Polyclonal Bik Antibody
APR06410G	Leading Biology	0.1 mg	EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bik . This antibody is tested and proven to work in the following applications:

BIK cloning plasmid
CSB-CL615677HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 483 Sequence: atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccatggaggttcttggcatgactgactctgaagaggacctggaccctatggaggacttcgattctttggaatgcatggagggcagtgacgcattggccct Show more
Description: A cloning plasmid for the BIK gene.

BIK (pS35) Antibody
abx148625-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

BIK (pT33) Antibody
20-abx009866	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	0 1 2
Shipped within 5-10 working days.

BIK (pT33) Antibody
abx011875-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Bik (pT33) Antibody
abx031835-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Bik (pT33) Antibody
abx031835-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

BIK antibody (Thr33)
70R-30645	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BIK antibody (Thr33)

BIK Blocking Peptide
33R-10891	Fitzgerald	50 ug	EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BIK antibody, catalog no. 70R-12017

BIK Blocking Peptide
3703BP-50	Biovision		EUR 153.00

BIK Blocking Peptide
DF6958-BP	Affbiotech	1mg	EUR 195.00

Anti-Bik Antibody
PB9755	BosterBio	100ug/vial	EUR 334.00

Anti-Bik (4G12)
YF-MA10094	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to Bik

Phospho-BIK (Ser35) Antibody
AF8246	Affbiotech	200ul	EUR 376.00
Description: BIK (Phospho-Ser35) Antibody detects endogenous levels of BIK only when phosphorylated at Ser35.

Phospho-BIK (Thr33) Antibody
AF3428	Affbiotech	200ul	EUR 304.00
Description: Phospho-BIK (Thr33) Antibody detects endogenous levels of BIK only when phosphorylated at Threonine 33.

BIK Cell ELISA Kit
abx595063-96tests	Abbexa	96 tests	EUR 637.00
Shipped within 1-2 weeks.

BIK (pT33) Blocking Peptide
20-abx062040	Abbexa	EUR 314.00 EUR 509.00	0 1
Shipped within 5-10 working days.

Bik BH3 Domain Antibody
abx027273-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Bik BH3 Domain Antibody
abx027273-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Phospho- BIK (Thr33) Antibody
ABF3428	Lifescience Market	100 ug	EUR 438.00

BIK (Phospho- Ser35) Antibody
ABF8246	Lifescience Market	100 ug	EUR 438.00

Human BIK shRNA Plasmid
20-abx950434	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

BIK (Phospho-Thr33) Antibody
12131-100ul	SAB	100ul	EUR 252.00

BIK (Phospho-Thr33) Antibody
12131-50ul	SAB	50ul	EUR 187.00

BIK (Phospho-Ser35) Antibody
12578-100ul	SAB	100ul	EUR 252.00

BIK (Phospho-Ser35) Antibody
12578-50ul	SAB	50ul	EUR 187.00

Mouse BIK shRNA Plasmid
20-abx969356	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Phospho-BIK (T33) Antibody
1-CSB-PA040303	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIK (T33). Recognizes Phospho-BIK (T33) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-BIK (S35) Antibody
1-CSB-PA040304	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIK (S35). Recognizes Phospho-BIK (S35) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-BIK (Thr33) Antibody
CSB-PA057445-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-BIK (Thr33). Recognizes Phospho-BIK (Thr33) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-BIK (Thr33) Antibody
CSB-PA057445-100ul	Cusabio	100ul	EUR 362.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-BIK (Thr33). Recognizes Phospho-BIK (Thr33) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

BIK Recombinant Protein (Human)
RP003043	ABM	100 ug	Ask for price

BIK Recombinant Protein (Rat)
RP192188	ABM	100 ug	Ask for price

BIK Recombinant Protein (Mouse)
RP119579	ABM	100 ug	Ask for price

Polyclonal BIK Antibody (N-Terminus)
APR02234G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIK (N-Terminus). This antibody is tested and proven to work in the following applications:

Phospho-BIK (Ser35) Blocking Peptide
AF8246-BP	Affbiotech	1mg	EUR 195.00

Phospho-BIK (Thr33) Blocking Peptide
AF3428-BP	Affbiotech	1mg	EUR 195.00

Polyclonal Phospho-Bik(T33) Antibody
APR05100G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-Bik(T33) . This antibody is tested and proven to work in the following applications:

BCL2 Interacting Killer (BIK) Antibody
20-abx324775	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

BIK ORF Vector (Human) (pORF)
ORF001015	ABM	1.0 ug DNA	EUR 95.00

Bik ORF Vector (Mouse) (pORF)
ORF039861	ABM	1.0 ug DNA	EUR 506.00

Bik ORF Vector (Rat) (pORF)
ORF064064	ABM	1.0 ug DNA	EUR 506.00

BIK (Phospho-Thr33) Polyclonal Conjugated Antibody
C12131	SAB	100ul	EUR 397.00

BIK (Phospho-Ser35) Polyclonal Conjugated Antibody
C12578	SAB	100ul	EUR 397.00

BIK Colorimetric Cell-Based ELISA Kit
EKC1060	BosterBio	100ul	EUR 572.00

BIK sgRNA CRISPR Lentivector set (Human)
K0183801	ABM	3 x 1.0 ug	EUR 339.00

Bcl-2-Interacting Killer (BIK) Antibody
20-abx320215	Abbexa	EUR 300.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Bcl-2-Interacting Killer (BIK) Antibody
abx411860-01mg	Abbexa	0.1 mg	EUR 509.00
Shipped within 1 week.

Bcl-2 Interacting Killer (BIK) Antibody
abx412207-50ug	Abbexa	50 ug	EUR 509.00
Shipped within 1 week.

Bik sgRNA CRISPR Lentivector set (Mouse)
K4988201	ABM	3 x 1.0 ug	EUR 339.00

Bik sgRNA CRISPR Lentivector set (Rat)
K6937001	ABM	3 x 1.0 ug	EUR 339.00

BIK sgRNA CRISPR Lentivector (Human) (Target 1)
K0183802	ABM	1.0 ug DNA	EUR 154.00

BIK sgRNA CRISPR Lentivector (Human) (Target 2)
K0183803	ABM	1.0 ug DNA	EUR 154.00

BIK sgRNA CRISPR Lentivector (Human) (Target 3)
K0183804	ABM	1.0 ug DNA	EUR 154.00

Rabbit Anti Bik (N-Terminal) Polyclonal Antibody
CPBT-66251RB	Creative Diagnostics	0.1 mg	EUR 580.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4988202	ABM	1.0 ug DNA	EUR 154.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4988203	ABM	1.0 ug DNA	EUR 154.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4988204	ABM	1.0 ug DNA	EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 1)
K6937002	ABM	1.0 ug DNA	EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 2)
K6937003	ABM	1.0 ug DNA	EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 3)
K6937004	ABM	1.0 ug DNA	EUR 154.00

BIK Protein Vector (Human) (pPB-C-His)
PV004057	ABM	500 ng	EUR 329.00

BIK Protein Vector (Human) (pPB-N-His)
PV004058	ABM	500 ng	EUR 329.00

BIK Protein Vector (Human) (pPM-C-HA)
PV004059	ABM	500 ng	EUR 329.00

BIK Protein Vector (Human) (pPM-C-His)
PV004060	ABM	500 ng	EUR 329.00

BIK Protein Vector (Human) (pPB-His-MBP)
PV326922	ABM	500 ng	EUR 329.00

BIK Protein Vector (Human) (pPB-His-GST)
PV326923	ABM	500 ng	EUR 329.00

BIK Protein Vector (Rat) (pPB-C-His)
PV256254	ABM	500 ng	EUR 603.00

BIK Protein Vector (Rat) (pPB-N-His)
PV256255	ABM	500 ng	EUR 603.00

BIK Protein Vector (Rat) (pPM-C-HA)
PV256256	ABM	500 ng	EUR 603.00

BIK Protein Vector (Rat) (pPM-C-His)
PV256257	ABM	500 ng	EUR 603.00

BIK Protein Vector (Mouse) (pPB-C-His)
PV159442	ABM	500 ng	EUR 603.00

BIK Protein Vector (Mouse) (pPB-N-His)
PV159443	ABM	500 ng	EUR 603.00