bik

BIK siRNA

20-abx909106
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIK siRNA

20-abx909107
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIK Antibody

ABF6428 100 ug
EUR 438.00

BIK antibody

70R-51465 100 ul
EUR 287.00
Description: Purified Polyclonal BIK antibody

BIK antibody

70R-30646 100 ug
EUR 327.00
Description: Rabbit polyclonal BIK antibody

BIK Antibody

ABD6958 100 ug
EUR 438.00

BIK Antibody

3703-100
EUR 316.00

BIK Antibody

3703-30T
EUR 146.00

BIK antibody

38406-100ul 100ul
EUR 252.00

Bik Antibody

24421-100ul 100ul
EUR 390.00

BIK antibody

70R-12017 100 ug
EUR 403.00
Description: Rabbit polyclonal BIK antibody

BIK Antibody

DF6958 200ul
EUR 304.00
Description: BIK Antibody detects endogenous levels of total BIK.

BIK Antibody

1-CSB-PA003373
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIK. Recognizes BIK from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

BIK Antibody

1-CSB-PA615677ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIK. Recognizes BIK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BIK Blocking Peptide

AF6428-BP 1mg
EUR 195.00

Polyclonal BIK Antibody

APR00174G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIK . This antibody is tested and proven to work in the following applications:

BIK Conjugated Antibody

C38406 100ul
EUR 397.00

Polyclonal Bik Antibody

APR06410G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bik . This antibody is tested and proven to work in the following applications:

BIK cloning plasmid

CSB-CL615677HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccatggaggttcttggcatgactgactctgaagaggacctggaccctatggaggacttcgattctttggaatgcatggagggcagtgacgcattggccct
  • Show more
Description: A cloning plasmid for the BIK gene.

BIK (pS35) Antibody

abx148625-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

BIK (pT33) Antibody

20-abx009866
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

BIK (pT33) Antibody

abx011875-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Bik (pT33) Antibody

abx031835-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Bik (pT33) Antibody

abx031835-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

BIK antibody (Thr33)

70R-30645 100 ug
EUR 327.00
Description: Rabbit polyclonal BIK antibody (Thr33)

BIK Blocking Peptide

33R-10891 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BIK antibody, catalog no. 70R-12017

BIK Blocking Peptide

3703BP-50
EUR 153.00

BIK Blocking Peptide

DF6958-BP 1mg
EUR 195.00

Anti-Bik Antibody

PB9755 100ug/vial
EUR 334.00

Anti-Bik (4G12)

YF-MA10094 100 ug
EUR 363.00
Description: Mouse monoclonal to Bik

Phospho-BIK (Ser35) Antibody

AF8246 200ul
EUR 376.00
Description: BIK (Phospho-Ser35) Antibody detects endogenous levels of BIK only when phosphorylated at Ser35.

Phospho-BIK (Thr33) Antibody

AF3428 200ul
EUR 304.00
Description: Phospho-BIK (Thr33) Antibody detects endogenous levels of BIK only when phosphorylated at Threonine 33.

BIK Cell ELISA Kit

abx595063-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

BIK (pT33) Blocking Peptide

20-abx062040
  • EUR 314.00
  • EUR 509.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Bik BH3 Domain Antibody

abx027273-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Bik BH3 Domain Antibody

abx027273-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Phospho- BIK (Thr33) Antibody

ABF3428 100 ug
EUR 438.00

BIK (Phospho- Ser35) Antibody

ABF8246 100 ug
EUR 438.00

Human BIK shRNA Plasmid

20-abx950434
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

BIK (Phospho-Thr33) Antibody

12131-100ul 100ul
EUR 252.00

BIK (Phospho-Thr33) Antibody

12131-50ul 50ul
EUR 187.00

BIK (Phospho-Ser35) Antibody

12578-100ul 100ul
EUR 252.00

BIK (Phospho-Ser35) Antibody

12578-50ul 50ul
EUR 187.00

Mouse BIK shRNA Plasmid

20-abx969356
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-BIK (T33) Antibody

1-CSB-PA040303
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIK (T33). Recognizes Phospho-BIK (T33) from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-BIK (S35) Antibody

1-CSB-PA040304
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIK (S35). Recognizes Phospho-BIK (S35) from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-BIK (Thr33) Antibody

CSB-PA057445-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-BIK (Thr33). Recognizes Phospho-BIK (Thr33) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

Phospho-BIK (Thr33) Antibody

CSB-PA057445-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-BIK (Thr33). Recognizes Phospho-BIK (Thr33) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

BIK Recombinant Protein (Human)

RP003043 100 ug Ask for price

BIK Recombinant Protein (Rat)

RP192188 100 ug Ask for price

BIK Recombinant Protein (Mouse)

RP119579 100 ug Ask for price

Polyclonal BIK Antibody (N-Terminus)

APR02234G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIK (N-Terminus). This antibody is tested and proven to work in the following applications:

Phospho-BIK (Ser35) Blocking Peptide

AF8246-BP 1mg
EUR 195.00

Phospho-BIK (Thr33) Blocking Peptide

AF3428-BP 1mg
EUR 195.00

Polyclonal Phospho-Bik(T33) Antibody

APR05100G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-Bik(T33) . This antibody is tested and proven to work in the following applications:

BCL2 Interacting Killer (BIK) Antibody

20-abx324775
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIK ORF Vector (Human) (pORF)

ORF001015 1.0 ug DNA
EUR 95.00

Bik ORF Vector (Mouse) (pORF)

ORF039861 1.0 ug DNA
EUR 506.00

Bik ORF Vector (Rat) (pORF)

ORF064064 1.0 ug DNA
EUR 506.00

BIK (Phospho-Thr33) Polyclonal Conjugated Antibody

C12131 100ul
EUR 397.00

BIK (Phospho-Ser35) Polyclonal Conjugated Antibody

C12578 100ul
EUR 397.00

BIK Colorimetric Cell-Based ELISA Kit

EKC1060 100ul
EUR 572.00

BIK sgRNA CRISPR Lentivector set (Human)

K0183801 3 x 1.0 ug
EUR 339.00

Bcl-2-Interacting Killer (BIK) Antibody

20-abx320215
  • EUR 300.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Bcl-2-Interacting Killer (BIK) Antibody

abx411860-01mg 0.1 mg
EUR 509.00
  • Shipped within 1 week.

Bcl-2 Interacting Killer (BIK) Antibody

abx412207-50ug 50 ug
EUR 509.00
  • Shipped within 1 week.

Bik sgRNA CRISPR Lentivector set (Mouse)

K4988201 3 x 1.0 ug
EUR 339.00

Bik sgRNA CRISPR Lentivector set (Rat)

K6937001 3 x 1.0 ug
EUR 339.00

BIK sgRNA CRISPR Lentivector (Human) (Target 1)

K0183802 1.0 ug DNA
EUR 154.00

BIK sgRNA CRISPR Lentivector (Human) (Target 2)

K0183803 1.0 ug DNA
EUR 154.00

BIK sgRNA CRISPR Lentivector (Human) (Target 3)

K0183804 1.0 ug DNA
EUR 154.00

Rabbit Anti Bik (N-Terminal) Polyclonal Antibody

CPBT-66251RB 0.1 mg
EUR 580.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4988202 1.0 ug DNA
EUR 154.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4988203 1.0 ug DNA
EUR 154.00

Bik sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4988204 1.0 ug DNA
EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 1)

K6937002 1.0 ug DNA
EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 2)

K6937003 1.0 ug DNA
EUR 154.00

Bik sgRNA CRISPR Lentivector (Rat) (Target 3)

K6937004 1.0 ug DNA
EUR 154.00

BIK Protein Vector (Human) (pPB-C-His)

PV004057 500 ng
EUR 329.00

BIK Protein Vector (Human) (pPB-N-His)

PV004058 500 ng
EUR 329.00

BIK Protein Vector (Human) (pPM-C-HA)

PV004059 500 ng
EUR 329.00

BIK Protein Vector (Human) (pPM-C-His)

PV004060 500 ng
EUR 329.00

BIK Protein Vector (Human) (pPB-His-MBP)

PV326922 500 ng
EUR 329.00

BIK Protein Vector (Human) (pPB-His-GST)

PV326923 500 ng
EUR 329.00

BIK Protein Vector (Rat) (pPB-C-His)

PV256254 500 ng
EUR 603.00

BIK Protein Vector (Rat) (pPB-N-His)

PV256255 500 ng
EUR 603.00

BIK Protein Vector (Rat) (pPM-C-HA)

PV256256 500 ng
EUR 603.00

BIK Protein Vector (Rat) (pPM-C-His)

PV256257 500 ng
EUR 603.00

BIK Protein Vector (Mouse) (pPB-C-His)

PV159442 500 ng
EUR 603.00

BIK Protein Vector (Mouse) (pPB-N-His)

PV159443 500 ng
EUR 603.00