CEACAM7

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

DL-CEACAM7-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7)

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

DL-CEACAM7-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7)

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

DLR-CEACAM7-Hu-48T 48T
EUR 517.00
  • Should the Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

DLR-CEACAM7-Hu-96T 96T
EUR 673.00
  • Should the Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

RD-CEACAM7-Hu-48Tests 48 Tests
EUR 521.00

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

RD-CEACAM7-Hu-96Tests 96 Tests
EUR 723.00

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

RDR-CEACAM7-Hu-48Tests 48 Tests
EUR 544.00

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

RDR-CEACAM7-Hu-96Tests 96 Tests
EUR 756.00

CEACAM7 Antibody

1-CSB-PA005167LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CEACAM7. Recognizes CEACAM7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CEACAM7 Antibody

45857-100ul 100ul
EUR 252.00

CEACAM7 Antibody

45857-50ul 50ul
EUR 187.00

CEACAM7 antibody

70R-9988 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CEACAM7 antibody

CEACAM7 antibody

70R-9989 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal CEACAM7 antibody

CEACAM7 Antibody

ABD9346 100 ug
EUR 438.00

CEACAM7 siRNA

20-abx911391
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CEACAM7 Antibody

DF9346 200ul
EUR 304.00
Description: CEACAM7 Antibody detects endogenous levels of total CEACAM7.

CEACAM7 Conjugated Antibody

C45857 100ul
EUR 397.00

CEACAM7 Polyclonal Antibody

A62254 100 µg
EUR 570.55
Description: kits suitable for this type of research

CEACAM7 cloning plasmid

CSB-CL005167HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 798
  • Sequence: ATGGGTTCCCCTTCAGCCTGTCCATACAGAGTGTGCATTCCCTGGCAGGGGCTCCTGCTCACAGCCTCGCTTTTAACCTTCTGGAACCTGCCAAACAGTGCCCAGACCAATATTGATGTCGTGCCGTTCAATGTCGCAGAAGGGAAGGAGGTCCTTCTAGTAGTCCATAATGAGTC
  • Show more
Description: A cloning plasmid for the CEACAM7 gene.

CEACAM7 Blocking Peptide

33R-3056 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CEACAM7 antibody, catalog no. 70R-9989

CEACAM7 Blocking Peptide

33R-6787 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CEACAM7 antibody, catalog no. 70R-9988

CEACAM7 Blocking Peptide

DF9346-BP 1mg
EUR 195.00

CEACAM7 Rabbit pAb

A8112-100ul 100 ul
EUR 308.00

CEACAM7 Rabbit pAb

A8112-200ul 200 ul
EUR 459.00

CEACAM7 Rabbit pAb

A8112-20ul 20 ul
EUR 183.00

CEACAM7 Rabbit pAb

A8112-50ul 50 ul
EUR 223.00

Anti-CEACAM7 antibody

STJ110411 100 µl
EUR 277.00
Description: This gene encodes a cell surface glycoprotein and member of the carcinoembryonic antigen (CEA) family of proteins. Expression of this gene may be downregulated in colon and rectal cancer. Additionally, lower expression levels of this gene may be predictive of rectal cancer recurrence. This gene is present in a CEA family gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants.

CEACAM7 Antibody, HRP conjugated

1-CSB-PA005167LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CEACAM7. Recognizes CEACAM7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CEACAM7 Antibody, FITC conjugated

1-CSB-PA005167LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CEACAM7. Recognizes CEACAM7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CEACAM7 Antibody, Biotin conjugated

1-CSB-PA005167LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CEACAM7. Recognizes CEACAM7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CEACAM7 protein (His tag)

80R-2830 50 ug
EUR 424.00
Description: Purified recombinant CEACAM7 protein (His tag)

Human CEACAM7 shRNA Plasmid

20-abx950780
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CEACAM7 ELISA KIT

ELI-34102h 96 Tests
EUR 824.00

CEACAM7 Recombinant Protein (Human)

RP037990 100 ug Ask for price

CEACAM7 Polyclonal Antibody, HRP Conjugated

A62255 100 µg
EUR 570.55
Description: fast delivery possible

CEACAM7 Polyclonal Antibody, FITC Conjugated

A62256 100 µg
EUR 570.55
Description: reagents widely cited

CEACAM7 Polyclonal Antibody, Biotin Conjugated

A62257 100 µg
EUR 570.55
Description: Ask the seller for details

CEACAM7 ORF Vector (Human) (pORF)

ORF012664 1.0 ug DNA
EUR 354.00

CEACAM7 sgRNA CRISPR Lentivector set (Human)

K0426901 3 x 1.0 ug
EUR 339.00

Anti-CEACAM7 (human) Monoclonal Antibody (BAC2)

M10385 100ug
EUR 398.00
Description: Mouse Monoclonal CEACAM7 (human) Antibody (BAC2). Validated in Flow Cytometry, IHC and tested in Human.

Recombinant Human CEACAM7/CGM2 (C-6His)

C926-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CEACAM7/CGM2 (C-6His)

C926-1mg 1mg
EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CEACAM7/CGM2 (C-6His)

C926-500ug 500ug
EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CEACAM7/CGM2 (C-6His)

C926-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

CEACAM7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0426902 1.0 ug DNA
EUR 154.00

CEACAM7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0426903 1.0 ug DNA
EUR 154.00

CEACAM7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0426904 1.0 ug DNA
EUR 154.00

CEACAM7 Protein Vector (Human) (pPB-C-His)

PV050653 500 ng
EUR 481.00

CEACAM7 Protein Vector (Human) (pPB-N-His)

PV050654 500 ng
EUR 481.00

CEACAM7 Protein Vector (Human) (pPM-C-HA)

PV050655 500 ng
EUR 481.00

CEACAM7 Protein Vector (Human) (pPM-C-His)

PV050656 500 ng
EUR 481.00

CEACAM7 3'UTR Luciferase Stable Cell Line

TU004160 1.0 ml
EUR 1521.00

CEACAM7 3'UTR GFP Stable Cell Line

TU054160 1.0 ml
EUR 1521.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-100ug

QP5814-ec-100ug 100ug
EUR 408.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-10ug

QP5814-ec-10ug 10ug
EUR 200.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-1mg

QP5814-ec-1mg 1mg
EUR 1632.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-200ug

QP5814-ec-200ug 200ug
EUR 634.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-500ug

QP5814-ec-500ug 500ug
EUR 1060.00

Recombinant Human CEACAM7 Protein, His-SUMO, E.coli-50ug

QP5814-ec-50ug 50ug
EUR 263.00

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx005686
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

abx029319-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

abx029319-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx104706
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx303384
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx171576
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx149191
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody

20-abx225103
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7)

1-CSB-EP005167HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Carcinoembryonic antigen-related cell adhesion molecule 7(CEACAM7) expressed in E.coli

Recombinant Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7)

4-RPC979Hu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14002
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 expressed in: E.coli

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Protein

20-abx065728
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody (HRP)

20-abx303385
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody (FITC)

20-abx303386
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody (Biotin)

20-abx303387
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) Antibody (Biotin)

20-abx272307
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CEACAM7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0426905 3 x 1.0 ug
EUR 376.00

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) ELISA Kit

20-abx151025
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E08C1600-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E08C1600-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E08C1600-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7)ELISA kit

201-12-2229 96 tests
EUR 440.00
  • This Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carcinoembryonic Antigen Related Cell Adhesion Molecule 7 (CEACAM7) CLIA Kit

20-abx494028
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Carcinoembryonic antigen-related cell adhesion molecule 7(CEACAM7) ELISA kit

CSB-EL005167HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carcinoembryonic antigen-related cell adhesion molecule 7 (CEACAM7) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Carcinoembryonic antigen-related cell adhesion molecule 7(CEACAM7) ELISA kit

1-CSB-EL005167HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Carcinoembryonic antigen-related cell adhesion molecule 7(CEACAM7) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E04C1600-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E04C1600-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E04C1600-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E06C1600-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E06C1600-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E06C1600-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) ELISA kit

E01C1600-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Carcinoembryonic antigen related cell adhesion molecule 7(CEACAM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.