CNTN4

CNTN4 siRNA

20-abx901167
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CNTN4 siRNA

20-abx912324
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CNTN4 siRNA

20-abx912325
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CNTN4 antibody

70R-36353 100 ug
EUR 327.00
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

34618-100ul 100ul
EUR 252.00

CNTN4 Antibody

34618-50ul 50ul
EUR 187.00

CNTN4 Antibody

46964-100ul 100ul
EUR 252.00

CNTN4 antibody

70R-16488 50 ul
EUR 435.00
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

1-CSB-PA005689GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNTN4 Antibody

1-CSB-PA007480
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

CNTN4 Antibody

1-CSB-PA810284ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNTN4 Antibody

1-CSB-PA810284ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CNTN4 Antibody

CSB-PA068627-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Antibody

CSB-PA068627-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Conjugated Antibody

C34618 100ul
EUR 397.00

anti- CNTN4 antibody

FNab01822 100µg
EUR 505.25
  • Immunogen: contactin 4
  • Uniprot ID: Q8IWV2
  • Gene ID: 152330
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against CNTN4

CNTN4 Rabbit pAb

A10339-100ul 100 ul
EUR 308.00

CNTN4 Rabbit pAb

A10339-200ul 200 ul
EUR 459.00

CNTN4 Rabbit pAb

A10339-20ul 20 ul
EUR 183.00

CNTN4 Rabbit pAb

A10339-50ul 50 ul
EUR 223.00

CNTN4 cloning plasmid

CSB-CL810284HU-10ug 10ug
EUR 696.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2094
  • Sequence: atggaagaaaatgtcttttgggaatgtaaagcaaatggaaggcctaagcctacatacaagtggctaaaaaatggcgaacctctgctaactcgggatagaattcaaattgagcaaggaacactcaacataacaatagtgaacctctcagatgctggcatgtatcagtgtttggcag
  • Show more
Description: A cloning plasmid for the CNTN4 gene.

Anti-CNTN4 antibody

PAab01822 100 ug
EUR 355.00

Anti-CNTN4 antibody

STJ112377 100 µl
EUR 277.00
Description: This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants.

Anti-CNTN4 (4B10)

YF-MA19959 100 ug
EUR 363.00
Description: Mouse monoclonal to CNTN4

Rat CNTN4 shRNA Plasmid

20-abx987319
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CNTN4 shRNA Plasmid

20-abx983068
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CNTN4 shRNA Plasmid

20-abx965736
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CNTN4 ELISA Kit

EHC0416 96Tests
EUR 521.00

Goat CNTN4 ELISA Kit

EGTC0416 96Tests
EUR 521.00

Canine CNTN4 ELISA Kit

ECC0416 96Tests
EUR 521.00

Bovine CNTN4 ELISA Kit

EBC0416 96Tests
EUR 521.00

Anserini CNTN4 ELISA Kit

EAC0416 96Tests
EUR 521.00

CNTN4 ELISA KIT|Human

EF006707 96 Tests
EUR 689.00

Porcine CNTN4 ELISA Kit

EPC0416 96Tests
EUR 521.00

Rat CNTN4 ELISA Kit

ERC0416 96Tests
EUR 521.00

Rabbit CNTN4 ELISA Kit

ERTC0416 96Tests
EUR 521.00

Mouse CNTN4 ELISA Kit

EMC0416 96Tests
EUR 521.00

Contactin 4 (CNTN4) Antibody

20-abx125691
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

20-abx111785
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

20-abx100907
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Contactin 4 (CNTN4) Antibody

20-abx014394
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

20-abx321202
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

20-abx322020
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

20-abx326366
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx331290-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx430919-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Contactin 4 (CNTN4) Antibody

abx231822-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Contactin 4 (CNTN4) Antibody

20-abx171918
  • EUR 815.00
  • EUR 425.00
  • 0
  • 1
  • Please enquire.

Recombinant Contactin 4 (CNTN4)

4-RPB210Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8IWV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Contactin 4 expressed in: E.coli

Guinea Pig CNTN4 ELISA Kit

EGC0416 96Tests
EUR 521.00

Human Contactin 4 (CNTN4) Protein

20-abx066112
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

CNTN4 ORF Vector (Human) (pORF)

ORF002519 1.0 ug DNA
EUR 95.00

Cntn4 ORF Vector (Rat) (pORF)

ORF065235 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041721 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041722 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041723 1.0 ug DNA
EUR 506.00

Pig Contactin 4 (CNTN4) ELISA Kit

abx360557-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rabbit Contactin 4 (CNTN4) ELISA Kit

abx363196-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Sheep Contactin 4 (CNTN4) ELISA Kit

abx364314-96tests 96 tests
EUR 926.00
  • Shipped within 5-12 working days.

Human CNTN4(Contactin 4) ELISA Kit

EH2852 96T
EUR 524.10
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8IWV2
  • Alias: CNTN4/Brain-derived immunoglobulin superfamily protein 2(BIG-2)/BIG-2/CNTN4/AXCAM/axonal-associated cell adhesion molecule/BIG-2Brain-derived immunoglobulin superfamily protein 2/contactin 4/
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Contactin- 4, CNTN4 ELISA KIT

ELI-25403h 96 Tests
EUR 824.00

Rat CNTN4(Contactin 4) ELISA Kit

ER0846 96T
EUR 524.10
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q62845
  • Alias: CNTN4/Brain-derived immunoglobulin superfamily protein 2(BIG-2)/BIG-2/CNTN4/AXCAM/axonal-associated cell adhesion molecule/BIG-2Brain-derived immunoglobulin superfamily protein 2/contactin 4/c
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Mouse Contactin- 4, Cntn4 ELISA KIT

ELI-51016m 96 Tests
EUR 865.00

CNTN4 sgRNA CRISPR Lentivector set (Human)

K0479201 3 x 1.0 ug
EUR 339.00

Human Contactin 4 (CNTN4) ELISA Kit

20-abx151151
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Mouse Contactin 4 (CNTN4) ELISA Kit

abx353300-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Chicken Contactin 4 (CNTN4) ELISA Kit

abx356717-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Monkey Contactin 4 (CNTN4) ELISA Kit

abx358703-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human Contactin 4 (CNTN4) CLIA Kit

20-abx492489
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Rat Contactin 4 (CNTN4) ELISA Kit

abx256814-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.