  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTN4 Antibody

46964-100ul 100ul
EUR 252.00

CNTN4 antibody

70R-36353 100 ug
EUR 327.00
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNTN4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CNTN4 Antibody

34618-100ul 100ul
EUR 252.00

CNTN4 Antibody

34618-50ul 50ul
EUR 187.00

CNTN4 antibody

70R-16488 50 ul
EUR 435.00
Description: Rabbit polyclonal CNTN4 antibody

CNTN4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNTN4 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Antibody

CSB-PA068627-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

CNTN4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CNTN4. Recognizes CNTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

CNTN4 Conjugated Antibody

C34618 100ul
EUR 397.00

CNTN4 cloning plasmid

CSB-CL810284HU-10ug 10ug
EUR 696.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2094
  • Sequence: atggaagaaaatgtcttttgggaatgtaaagcaaatggaaggcctaagcctacatacaagtggctaaaaaatggcgaacctctgctaactcgggatagaattcaaattgagcaaggaacactcaacataacaatagtgaacctctcagatgctggcatgtatcagtgtttggcag
  • Show more
Description: A cloning plasmid for the CNTN4 gene.

Anti-CNTN4 (4B10)

YF-MA19959 100 ug
EUR 363.00
Description: Mouse monoclonal to CNTN4

Anti-CNTN4 antibody

PAab01822 100 ug
EUR 355.00

CNTN4 Rabbit pAb

A10339-100ul 100 ul
EUR 308.00

CNTN4 Rabbit pAb

A10339-200ul 200 ul
EUR 459.00

CNTN4 Rabbit pAb

A10339-20ul 20 ul
EUR 183.00

CNTN4 Rabbit pAb

A10339-50ul 50 ul
EUR 223.00

anti- CNTN4 antibody

FNab01822 100µg
EUR 505.25
  • Immunogen: contactin 4
  • Uniprot ID: Q8IWV2
  • Gene ID: 152330
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against CNTN4

Anti-CNTN4 antibody

STJ112377 100 µl
EUR 277.00
Description: This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants.

Contactin 4 (CNTN4) Antibody

abx231822-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF006707 96 Tests
EUR 689.00

Mouse CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CNTN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Contactin 4 (CNTN4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx331290-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

abx430919-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Contactin 4 (CNTN4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anserini CNTN4 ELISA Kit

EAC0416 96Tests
EUR 521.00

Recombinant Contactin 4 (CNTN4)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Contactin 4 expressed in: E.coli

Canine CNTN4 ELISA Kit

ECC0416 96Tests
EUR 521.00

Bovine CNTN4 ELISA Kit

EBC0416 96Tests
EUR 521.00


ERC0416 96Tests
EUR 521.00

Rabbit CNTN4 ELISA Kit

ERTC0416 96Tests
EUR 521.00


EHC0416 96Tests
EUR 521.00

Porcine CNTN4 ELISA Kit

EPC0416 96Tests
EUR 521.00


EMC0416 96Tests
EUR 521.00


EGTC0416 96Tests
EUR 521.00

Human Contactin 4 (CNTN4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CNTN4 ORF Vector (Human) (pORF)

ORF002519 1.0 ug DNA
EUR 95.00

Cntn4 ORF Vector (Rat) (pORF)

ORF065235 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041721 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041722 1.0 ug DNA
EUR 506.00

Cntn4 ORF Vector (Mouse) (pORF)

ORF041723 1.0 ug DNA
EUR 506.00

Guinea Pig CNTN4 ELISA Kit

EGC0416 96Tests
EUR 521.00

Human CNTN4(Contactin 4) ELISA Kit

E-EL-H1501-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human CNTN4. You can calculate the concentration of Human CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Human CNTN4(Contactin 4) ELISA Kit

E-EL-H1501-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human CNTN4. You can calculate the concentration of Human CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Mouse CNTN4(Contactin 4) ELISA Kit

E-EL-M2670-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Mouse CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Mouse CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Mouse CNTN4. You can calculate the concentration of Mouse CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Mouse CNTN4(Contactin 4) ELISA Kit

E-EL-M2670-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Mouse CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Mouse CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Mouse CNTN4. You can calculate the concentration of Mouse CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Rat CNTN4(Contactin 4) ELISA Kit

E-EL-R0268-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Rat CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Rat CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Rat CNTN4. You can calculate the concentration of Rat CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Rat CNTN4(Contactin 4) ELISA Kit

E-EL-R0268-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CNTN4. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Rat CNTN4 and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Rat CNTN4, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Rat CNTN4. You can calculate the concentration of Rat CNTN4 in the samples by comparing the OD of the samples to the standard curve.

Human Contactin- 4, CNTN4 ELISA KIT

ELI-25403h 96 Tests
EUR 824.00

Mouse Contactin- 4, Cntn4 ELISA KIT

ELI-51016m 96 Tests
EUR 865.00

Rat Contactin 4 (CNTN4) ELISA Kit

abx256814-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Human Contactin 4 (CNTN4) ELISA Kit

abx252238-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Sheep Contactin 4 (CNTN4) ELISA Kit

abx364314-96tests 96 tests
EUR 926.00
  • Shipped within 5-12 working days.

Monkey Contactin 4 (CNTN4) ELISA Kit

abx358703-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Pig Contactin 4 (CNTN4) ELISA Kit

abx360557-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rabbit Contactin 4 (CNTN4) ELISA Kit

abx363196-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.