DCTN6

DCTN6 Antibody

1-CSB-PA006569ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DCTN6 Antibody

1-CSB-PA006569GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DCTN6 Antibody

1-CSB-PA694176
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DCTN6 Antibody

36406-100ul 100ul
EUR 252.00

DCTN6 antibody

70R-16764 50 ul
EUR 435.00
Description: Rabbit polyclonal DCTN6 antibody

DCTN6 siRNA

20-abx913705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCTN6 siRNA

20-abx913706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCTN6 Antibody

1-CSB-PA572419
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN6. Recognizes DCTN6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:100-1:300

anti-DCTN6

YF-PA17161 50 ug
EUR 363.00
Description: Mouse polyclonal to DCTN6

DCTN6 Antibody

DF12381 200ul
EUR 304.00
Description: DCTN6 antibody detects endogenous levels of DCTN6.

DCTN6 Conjugated Antibody

C36406 100ul
EUR 397.00

DCTN6 cloning plasmid

CSB-CL006569HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 573
  • Sequence: atggcggagaagactcaaaagagtgtgaagattgctcctggagcagttgtatgtgtagaaagtgaaatcagaggagatgtaactatcggacctcggacagtgatccaccctaaagcaagaattattgcggaagccgggccaatagtgattggcgaagggaacctaatagaagaaca
  • Show more
Description: A cloning plasmid for the DCTN6 gene.

DCTN6 Polyclonal Antibody

E-AB-11147-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which conf
  • Show more
Description: Rabbit antibody against Human,Mouse DCTN6 for WB,IHC,ELISA applications.

DCTN6 Polyclonal Antibody

E-AB-11147-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which conf
  • Show more
Description: Rabbit antibody against Human,Mouse DCTN6 for WB,IHC,ELISA applications.

DCTN6 Polyclonal Antibody

E-AB-11147-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which conf
  • Show more
Description: Rabbit antibody against Human,Mouse DCTN6 for WB,IHC,ELISA applications.

Anti-DCTN6 antibody

PAab02276 100 ug
EUR 355.00

pCMV-SPORT6-DCTN6

PVT13686 2 ug
EUR 391.00

DCTN6 Blocking Peptide

DF12381-BP 1mg
EUR 195.00

anti- DCTN6 antibody

FNab02276 100µg
EUR 505.25
  • Immunogen: dynactin 6
  • Uniprot ID: O00399
  • Gene ID: 10671
  • Research Area: Metabolism
Description: Antibody raised against DCTN6

DCTN6 Rabbit pAb

A8316-100ul 100 ul
EUR 308.00

DCTN6 Rabbit pAb

A8316-200ul 200 ul
EUR 459.00

DCTN6 Rabbit pAb

A8316-20ul 20 ul
EUR 183.00

DCTN6 Rabbit pAb

A8316-50ul 50 ul
EUR 223.00

Anti-DCTN6 antibody

STJ110614 100 µl
EUR 277.00
Description: The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known.

Mouse DCTN6 shRNA Plasmid

20-abx973414
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCTN6 protein (His tag)

80R-3967 100 ug
EUR 349.00
Description: Recombinant Human DCTN6 protein

Human DCTN6 shRNA Plasmid

20-abx957278
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DCTN6 ELISA KIT|Human

EF009032 96 Tests
EUR 689.00

DCTN6 Recombinant Protein (Rat)

RP197501 100 ug Ask for price

DCTN6 Recombinant Protein (Human)

RP008869 100 ug Ask for price

DCTN6 Recombinant Protein (Mouse)

RP128192 100 ug Ask for price

Polyclonal DCTN6 Antibody (Center)

APR07505G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DCTN6 (Center). This antibody is tested and proven to work in the following applications:

Dynactin Subunit 6 (DCTN6) Antibody

20-abx005907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

abx029713-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

abx029713-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

20-abx112191
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

20-abx322671
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

20-abx321395
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

20-abx211691
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

20-abx212864
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynactin Subunit 6 (DCTN6) Antibody

abx232276-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Human Dynactin subunit 6 (DCTN6)

1-CSB-EP006569HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 47.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dynactin subunit 6(DCTN6) expressed in E.coli

Dctn6 ORF Vector (Mouse) (pORF)

ORF042732 1.0 ug DNA
EUR 506.00

DCTN6 ORF Vector (Human) (pORF)

ORF002957 1.0 ug DNA
EUR 95.00

Dctn6 ORF Vector (Rat) (pORF)

ORF065835 1.0 ug DNA
EUR 506.00

Dctn6 sgRNA CRISPR Lentivector set (Mouse)

K3424901 3 x 1.0 ug
EUR 339.00

Human Dynactin 6 (DCTN6)ELISA Kit

201-12-2664 96 tests
EUR 440.00
  • This Dynactin 6 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

DCTN6 sgRNA CRISPR Lentivector set (Human)

K0567701 3 x 1.0 ug
EUR 339.00

Dctn6 sgRNA CRISPR Lentivector set (Rat)

K6415601 3 x 1.0 ug
EUR 339.00

DCTN6 Dynactin 6 Human Recombinant Protein

PROTO00399 Regular: 20ug
EUR 317.00
Description: DCTN6 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 213 amino acids (1-190 a.a) and having a molecular mass of 23.1kDa. DCTN6 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Dynactin 6(DCTN6)ELISA Kit

QY-E03777 96T
EUR 361.00

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3424902 1.0 ug DNA
EUR 154.00

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3424903 1.0 ug DNA
EUR 154.00

Dctn6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3424904 1.0 ug DNA
EUR 154.00

Human Dynactin Subunit 6 (DCTN6) ELISA Kit

abx386814-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Bovine Dynactin subunit 6, DCTN6 ELISA KIT

ELI-31033b 96 Tests
EUR 928.00

Human Dynactin subunit 6, DCTN6 ELISA KIT

ELI-08984h 96 Tests
EUR 824.00

Mouse Dynactin subunit 6, Dctn6 ELISA KIT

ELI-47015m 96 Tests
EUR 865.00

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 1)

K0567702 1.0 ug DNA
EUR 154.00

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 2)

K0567703 1.0 ug DNA
EUR 154.00

DCTN6 sgRNA CRISPR Lentivector (Human) (Target 3)

K0567704 1.0 ug DNA
EUR 154.00

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6415602 1.0 ug DNA
EUR 154.00

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6415603 1.0 ug DNA
EUR 154.00

Dctn6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6415604 1.0 ug DNA
EUR 154.00

DCTN6 Protein Vector (Mouse) (pPB-C-His)

PV170926 500 ng
EUR 603.00

DCTN6 Protein Vector (Mouse) (pPB-N-His)

PV170927 500 ng
EUR 603.00

DCTN6 Protein Vector (Mouse) (pPM-C-HA)

PV170928 500 ng
EUR 603.00

DCTN6 Protein Vector (Mouse) (pPM-C-His)

PV170929 500 ng
EUR 603.00

DCTN6 Protein Vector (Human) (pPB-C-His)

PV011825 500 ng
EUR 329.00

DCTN6 Protein Vector (Human) (pPB-N-His)

PV011826 500 ng
EUR 329.00