DDOST

DDOST siRNA

20-abx913757
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDOST siRNA

20-abx913758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDOST Antibody

47035-100ul 100ul
EUR 252.00

DDOST Antibody

1-CSB-PA006594GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DDOST. Recognizes DDOST from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DDOST antibody

70R-15111 100 ug
EUR 327.00
Description: Rabbit polyclonal DDOST antibody

DDOST antibody

70R-1895 100 ug
EUR 377.00
Description: Rabbit polyclonal DDOST antibody raised against the N terminal of DDOST

DDOST antibody

70R-16777 50 ul
EUR 435.00
Description: Rabbit polyclonal DDOST antibody

pOTB7-DDOST

PVT14583 2 ug
EUR 495.00

anti-DDOST

YF-PA11322 100 ug
EUR 403.00
Description: Rabbit polyclonal to DDOST

anti-DDOST

YF-PA23580 50 ul
EUR 334.00
Description: Mouse polyclonal to DDOST

DDOST Conjugated Antibody

C47035 100ul
EUR 397.00

DDOST Blocking Peptide

33R-8698 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDOST antibody, catalog no. 70R-1895

DDOST antibody (HRP)

60R-1179 100 ug
EUR 327.00
Description: Rabbit polyclonal DDOST antibody (HRP)

DDOST antibody (FITC)

60R-1180 100 ug
EUR 327.00
Description: Rabbit polyclonal DDOST antibody (FITC)

DDOST antibody (biotin)

60R-1181 100 ug
EUR 327.00
Description: Rabbit polyclonal DDOST antibody (biotin)

DDOST cloning plasmid

CSB-CL006594HU-10ug 10ug
EUR 493.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1371
  • Sequence: atggggtacttccggtgtgcaggtgctgggtccttcggcaggaggaggaagatggagcccagcaccgcggcccgggcttgggccctcttttggttgctgctgcccttgcttggcgcggtttgcgccagcggaccccgcaccttagtgctgctggacaacctcaacgtgcgggaga
  • Show more
Description: A cloning plasmid for the DDOST gene.

pDONR223-DDOST Plasmid

PVTB01117-1 2 ug
EUR 356.00

pECMV-DDOST-3

PVT14761 2 ug
EUR 325.00

Anti-DDOST (2D7)

YF-MA12660 100 ug
EUR 363.00
Description: Mouse monoclonal to DDOST

Anti-DDOST antibody

PAab02290 100 ug
EUR 386.00

DDOST Rabbit pAb

A9056-100ul 100 ul
EUR 308.00

DDOST Rabbit pAb

A9056-200ul 200 ul
EUR 459.00

DDOST Rabbit pAb

A9056-20ul 20 ul
EUR 183.00

DDOST Rabbit pAb

A9056-50ul 50 ul
EUR 223.00

anti- DDOST antibody

FNab02290 100µg
EUR 548.75
  • Immunogen: dolichyl-diphosphooligosaccharide-protein glycosyltransferase
  • Uniprot ID: P39656
  • Gene ID: 1650
  • Research Area: Metabolism
Description: Antibody raised against DDOST

Anti-DDOST antibody

STJ111545 100 µl
EUR 277.00
Description: This gene encodes a component of the oligosaccharyltransferase complex which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues on nascent polypeptides in the lumen of the rough endoplasmic reticulum. The protein complex co-purifies with ribosomes. The product of this gene is also implicated in the processing of advanced glycation endproducts (AGEs), which form from non-enzymatic reactions between sugars and proteins or lipids and are associated with aging and hyperglycemia.

Human DDOST shRNA Plasmid

20-abx951163
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDOST ELISA KIT|Human

EF006177 96 Tests
EUR 689.00

Human DDOST ELISA Kit

ELA-E2093h 96 Tests
EUR 824.00

Canine DDOST ELISA KIT

ELI-06718d 96 Tests
EUR 928.00

Chicken DDOST ELISA KIT

ELI-06721c 96 Tests
EUR 928.00

Mouse DDOST shRNA Plasmid

20-abx969972
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DDOST shRNA Plasmid

20-abx989782
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDOST Recombinant Protein (Human)

RP008929 100 ug Ask for price

DDOST Recombinant Protein (Mouse)

RP128309 100 ug Ask for price

DDOST Recombinant Protein (Rat)

RP197576 100 ug Ask for price

Mouse DDOST 48 ELISA Kit

ELI-06716m 96 Tests
EUR 865.00

DDOST ORF Vector (Human) (pORF)

ORF002977 1.0 ug DNA
EUR 95.00

Ddost ORF Vector (Rat) (pORF)

ORF065860 1.0 ug DNA
EUR 506.00

Ddost ORF Vector (Mouse) (pORF)

ORF042771 1.0 ug DNA
EUR 506.00

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

abx232290-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

20-abx109736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

20-abx123811
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

20-abx104714
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

20-abx104715
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody

20-abx112154
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ddost sgRNA CRISPR Lentivector set (Rat)

K7162601 3 x 1.0 ug
EUR 339.00

DDOST sgRNA CRISPR Lentivector set (Human)

K0570101 3 x 1.0 ug
EUR 339.00

Ddost sgRNA CRISPR Lentivector set (Mouse)

K3843001 3 x 1.0 ug
EUR 339.00

Recombinant Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST)

4-RPJ279Hu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P39656
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase expressed in: E.coli

Recombinant Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST)

4-RPJ279Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O54734
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase expressed in: E.coli

Human Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Protein

20-abx066360
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Protein

20-abx066361
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody (Biotin)

20-abx272569
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody (Biotin)

20-abx273027
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody Pair

abx117408-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody (Biotin)

20-abx105356
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody (HRP)

20-abx108194
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dolichyl Diphosphooligosaccharide Protein Glycosyltransferase (DDOST) Antibody (FITC)

20-abx106775
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ddost sgRNA CRISPR Lentivector (Rat) (Target 1)

K7162602 1.0 ug DNA
EUR 154.00

Ddost sgRNA CRISPR Lentivector (Rat) (Target 2)

K7162603 1.0 ug DNA
EUR 154.00

Ddost sgRNA CRISPR Lentivector (Rat) (Target 3)

K7162604 1.0 ug DNA
EUR 154.00

DDOST sgRNA CRISPR Lentivector (Human) (Target 1)

K0570102 1.0 ug DNA
EUR 154.00

DDOST sgRNA CRISPR Lentivector (Human) (Target 2)

K0570103 1.0 ug DNA
EUR 154.00

DDOST sgRNA CRISPR Lentivector (Human) (Target 3)

K0570104 1.0 ug DNA
EUR 154.00

DDOST Protein Vector (Rat) (pPB-C-His)

PV263438 500 ng
EUR 603.00

DDOST Protein Vector (Rat) (pPB-N-His)

PV263439 500 ng
EUR 603.00

DDOST Protein Vector (Rat) (pPM-C-HA)

PV263440 500 ng
EUR 603.00

DDOST Protein Vector (Rat) (pPM-C-His)

PV263441 500 ng
EUR 603.00

DDOST 3'UTR Luciferase Stable Cell Line

TU005666 1.0 ml
EUR 4617.00