DERL2 siRNA
20-abx914023	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

DERL2 Polyclonal Antibody
ES11968-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL2 Polyclonal Antibody
ES11968-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL2 Polyclonal Antibody
ABP58354-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human DERL2 protein Applications tips:
Description: A polyclonal antibody for detection of DERL2 from Human, Mouse. This DERL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL2 protein

DERL2 Polyclonal Antibody
ABP58354-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human DERL2 protein Applications tips:
Description: A polyclonal antibody for detection of DERL2 from Human, Mouse. This DERL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL2 protein

DERL2 Polyclonal Antibody
ABP58354-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human DERL2 protein Applications tips:
Description: A polyclonal antibody for detection of DERL2 from Human, Mouse. This DERL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL2 protein

DERL2 cloning plasmid
CSB-CL880924HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 720 Sequence: atggcgtaccagagcttgcggctggagtacctgcagatcccaccggtcagccgcgcctacaccactgcctgcgtcctcaccaccgccgccgtgcagttggaattgatcacaccttttcagttgtacttcaatcctgaattaatctttaaacactttcaaatatggagattaatcac Show more
Description: A cloning plasmid for the DERL2 gene.

Anti-DERL2 antibody
STJ193126	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to DERL2

Mouse DERL2 shRNA Plasmid
20-abx980207	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Derlin-2 (DERL2) Antibody
abx030935-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Derlin-2 (DERL2) Antibody
abx030935-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Human DERL2 shRNA Plasmid
20-abx959450	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

DERL2 Recombinant Protein (Human)
RP009169	ABM	100 ug	Ask for price

DERL2 Recombinant Protein (Mouse)
RP128807	ABM	100 ug	Ask for price

Polyclonal DERL2 / Derlin-2 Antibody
APR15723G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL2 / Derlin-2 . This antibody is tested and proven to work in the following applications:

DERL2 ORF Vector (Human) (pORF)
ORF003057	ABM	1.0 ug DNA	EUR 95.00

Derl2 ORF Vector (Mouse) (pORF)
ORF042937	ABM	1.0 ug DNA	EUR 506.00

Mouse Derlin- 2, Derl2 ELISA KIT
ELI-26518m	Lifescience Market	96 Tests	EUR 865.00

Human Derlin- 2, DERL2 ELISA KIT
ELI-48610h	Lifescience Market	96 Tests	EUR 824.00

DERL2 sgRNA CRISPR Lentivector set (Human)
K0585301	ABM	3 x 1.0 ug	EUR 339.00

Derl2 sgRNA CRISPR Lentivector set (Mouse)
K4642101	ABM	3 x 1.0 ug	EUR 339.00

Human Derlin 2(DERL2)ELISA Kit
QY-E04983	Qayee Biotechnology	96T	EUR 361.00

DERL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0585302	ABM	1.0 ug DNA	EUR 154.00

DERL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0585303	ABM	1.0 ug DNA	EUR 154.00

DERL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0585304	ABM	1.0 ug DNA	EUR 154.00

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4642102	ABM	1.0 ug DNA	EUR 154.00

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4642103	ABM	1.0 ug DNA	EUR 154.00

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4642104	ABM	1.0 ug DNA	EUR 154.00

ELISA kit for Mouse Derlin-2 (DERL2)
KTE71308-48T	Abbkine	48T	EUR 332.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-2 (DERL2)
KTE71308-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-2 (DERL2)
KTE71308-96T	Abbkine	96T	EUR 539.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)
KTE62090-48T	Abbkine	48T	EUR 332.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)
KTE62090-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)
KTE62090-96T	Abbkine	96T	EUR 539.00
Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL2 Protein Vector (Human) (pPB-C-His)
PV012225	ABM	500 ng	EUR 329.00

DERL2 Protein Vector (Human) (pPB-N-His)
PV012226	ABM	500 ng	EUR 329.00

DERL2 Protein Vector (Human) (pPM-C-HA)
PV012227	ABM	500 ng	EUR 329.00

DERL2 Protein Vector (Human) (pPM-C-His)
PV012228	ABM	500 ng	EUR 329.00

DERL2 Protein Vector (Mouse) (pPB-C-His)
PV171746	ABM	500 ng	EUR 603.00

DERL2 Protein Vector (Mouse) (pPB-N-His)
PV171747	ABM	500 ng	EUR 603.00

DERL2 Protein Vector (Mouse) (pPM-C-HA)
PV171748	ABM	500 ng	EUR 603.00

DERL2 Protein Vector (Mouse) (pPM-C-His)
PV171749	ABM	500 ng	EUR 603.00

Derl2 3'UTR GFP Stable Cell Line
TU155081	ABM	1.0 ml	Ask for price

DERL2 3'UTR Luciferase Stable Cell Line
TU005833	ABM	1.0 ml	EUR 2333.00

Derl2 3'UTR Luciferase Stable Cell Line
TU105081	ABM	1.0 ml	Ask for price

DERL2 3'UTR GFP Stable Cell Line
TU055833	ABM	1.0 ml	EUR 2333.00

DERL2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0585305	ABM	3 x 1.0 ug	EUR 376.00

Derl2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4642105	ABM	3 x 1.0 ug	EUR 376.00

DERL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0585306	ABM	1.0 ug DNA	EUR 167.00

DERL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0585307	ABM	1.0 ug DNA	EUR 167.00

DERL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0585308	ABM	1.0 ug DNA	EUR 167.00

Derl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4642106	ABM	1.0 ug DNA	EUR 167.00

Derl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4642107	ABM	1.0 ug DNA	EUR 167.00

Derl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4642108	ABM	1.0 ug DNA	EUR 167.00