DERL3

DERL3 siRNA

20-abx914025
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DERL3 antibody

70R-6365 50 ug
EUR 467.00
Description: Rabbit polyclonal DERL3 antibody raised against the middle region of DERL3

DERL3 antibody

70R-6366 50 ug
EUR 467.00
Description: Rabbit polyclonal DERL3 antibody raised against the C terminal of DERL3

DERL3 Polyclonal Antibody

ABP58355-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human DERL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Polyclonal Antibody

ABP58355-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human DERL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Polyclonal Antibody

ABP58355-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human DERL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Polyclonal Antibody

ES11969-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 Polyclonal Antibody

ES11969-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 Blocking Peptide

33R-2886 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6365

DERL3 Blocking Peptide

33R-10295 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6366

DERL3 cloning plasmid

CSB-CL836283HU-10ug 10ug
EUR 308.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcac
  • Show more
Description: A cloning plasmid for the DERL3 gene.

Anti-DERL3 antibody

STJ193127 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to DERL3

Human DERL3 shRNA Plasmid

20-abx964027
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DERL3 shRNA Plasmid

20-abx977193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DERL3 Recombinant Protein (Human)

RP009172 100 ug Ask for price

DERL3 Recombinant Protein (Mouse)

RP128810 100 ug Ask for price

DERL3 Recombinant Protein (Rat)

RP197897 100 ug Ask for price

DERL3 ORF Vector (Human) (pORF)

ORF003058 1.0 ug DNA
EUR 95.00

Derl3 ORF Vector (Rat) (pORF)

ORF065967 1.0 ug DNA
EUR 506.00

Derl3 ORF Vector (Mouse) (pORF)

ORF042938 1.0 ug DNA
EUR 506.00

Human Derlin- 3, DERL3 ELISA KIT

ELI-26357h 96 Tests
EUR 824.00

Bovine Derlin- 3, DERL3 ELISA KIT

ELI-46941b 96 Tests
EUR 928.00

Mouse Derlin- 3, Derl3 ELISA KIT

ELI-47008m 96 Tests
EUR 865.00

DERL3 sgRNA CRISPR Lentivector set (Human)

K0585401 3 x 1.0 ug
EUR 339.00

Derl3 sgRNA CRISPR Lentivector set (Mouse)

K4041101 3 x 1.0 ug
EUR 339.00

Derl3 sgRNA CRISPR Lentivector set (Rat)

K6111901 3 x 1.0 ug
EUR 339.00

Human Derlin 3(DERL3)ELISA Kit

QY-E04982 96T
EUR 361.00

DERL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0585402 1.0 ug DNA
EUR 154.00

DERL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0585403 1.0 ug DNA
EUR 154.00

DERL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0585404 1.0 ug DNA
EUR 154.00

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4041102 1.0 ug DNA
EUR 154.00

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4041103 1.0 ug DNA
EUR 154.00

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4041104 1.0 ug DNA
EUR 154.00

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-48T 48T
EUR 332.00
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-5platesof96wells 5 plates of 96 wells
EUR 2115.00
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-96T 96T
EUR 539.00
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-48T 48T
EUR 354.00
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-5platesof96wells 5 plates of 96 wells
EUR 2252.00
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-96T 96T
EUR 572.00
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL3 Protein Vector (Rat) (pPB-C-His)

PV263866 500 ng
EUR 603.00

DERL3 Protein Vector (Rat) (pPB-N-His)

PV263867 500 ng
EUR 603.00

DERL3 Protein Vector (Rat) (pPM-C-HA)

PV263868 500 ng
EUR 603.00

DERL3 Protein Vector (Rat) (pPM-C-His)

PV263869 500 ng
EUR 603.00

DERL3 3'UTR Luciferase Stable Cell Line

TU005834 1.0 ml
EUR 1521.00

DERL3 3'UTR GFP Stable Cell Line

TU055834 1.0 ml
EUR 1521.00

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6111902 1.0 ug DNA
EUR 154.00

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6111903 1.0 ug DNA
EUR 154.00

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6111904 1.0 ug DNA
EUR 154.00

DERL3 Protein Vector (Mouse) (pPB-C-His)

PV171750 500 ng
EUR 603.00

DERL3 Protein Vector (Mouse) (pPB-N-His)

PV171751 500 ng
EUR 603.00

DERL3 Protein Vector (Mouse) (pPM-C-HA)

PV171752 500 ng
EUR 603.00

DERL3 Protein Vector (Mouse) (pPM-C-His)

PV171753 500 ng
EUR 603.00

Derl3 3'UTR GFP Stable Cell Line

TU155082 1.0 ml Ask for price

Derl3 3'UTR GFP Stable Cell Line

TU253354 1.0 ml Ask for price

Derl3 3'UTR Luciferase Stable Cell Line

TU105082 1.0 ml Ask for price

Derl3 3'UTR Luciferase Stable Cell Line

TU203354 1.0 ml Ask for price

DERL3 Protein Vector (Human) (pPB-C-His)

PV012229 500 ng
EUR 329.00

DERL3 Protein Vector (Human) (pPB-N-His)

PV012230 500 ng
EUR 329.00

DERL3 Protein Vector (Human) (pPM-C-HA)

PV012231 500 ng
EUR 329.00

DERL3 Protein Vector (Human) (pPM-C-His)

PV012232 500 ng
EUR 329.00

Polyclonal Derlin-3 / DERL3 Antibody (N-Terminus)

APR15724G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Derlin-3 / DERL3 (N-Terminus). This antibody is tested and proven to work in the following applications:

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0585405 3 x 1.0 ug
EUR 376.00

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4041105 3 x 1.0 ug
EUR 376.00

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6111905 3 x 1.0 ug
EUR 376.00

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0585406 1.0 ug DNA
EUR 167.00

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0585407 1.0 ug DNA
EUR 167.00

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0585408 1.0 ug DNA
EUR 167.00

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4041106 1.0 ug DNA
EUR 167.00

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4041107 1.0 ug DNA
EUR 167.00

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4041108 1.0 ug DNA
EUR 167.00