DERL3 siRNA
20-abx914025	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DERL3 antibody
70R-6365	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DERL3 antibody raised against the middle region of DERL3

DERL3 antibody
70R-6366	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DERL3 antibody raised against the C terminal of DERL3

DERL3 Polyclonal Antibody
ES11969-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 Polyclonal Antibody
ES11969-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 Polyclonal Antibody
ABP58355-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human DERL3 protein Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Polyclonal Antibody
ABP58355-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DERL3 protein Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Polyclonal Antibody
ABP58355-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DERL3 protein Applications tips:
Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein

DERL3 Blocking Peptide
33R-10295	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6366

DERL3 Blocking Peptide
33R-2886	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6365

DERL3 cloning plasmid
CSB-CL836283HU-10ug	Cusabio	10ug	EUR 308
Formulation: 10 μg plasmid + 200μl Glycerol Length: 708 Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcac Show more
Description: A cloning plasmid for the DERL3 gene.

Anti-DERL3 antibody
STJ193127	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DERL3

Mouse DERL3 shRNA Plasmid
20-abx977193	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DERL3 shRNA Plasmid
20-abx964027	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DERL3 Recombinant Protein (Human)
RP009172	ABM	100 ug	Ask for price

DERL3 Recombinant Protein (Rat)
RP197897	ABM	100 ug	Ask for price

DERL3 Recombinant Protein (Mouse)
RP128810	ABM	100 ug	Ask for price

DERL3 ORF Vector (Human) (pORF)
ORF003058	ABM	1.0 ug DNA	EUR 95

Derl3 ORF Vector (Rat) (pORF)
ORF065967	ABM	1.0 ug DNA	EUR 506

Derl3 ORF Vector (Mouse) (pORF)
ORF042938	ABM	1.0 ug DNA	EUR 506

Human Derlin- 3, DERL3 ELISA KIT
ELI-26357h	Lifescience Market	96 Tests	EUR 824

Bovine Derlin- 3, DERL3 ELISA KIT
ELI-46941b	Lifescience Market	96 Tests	EUR 928

Mouse Derlin- 3, Derl3 ELISA KIT
ELI-47008m	Lifescience Market	96 Tests	EUR 865

DERL3 sgRNA CRISPR Lentivector set (Human)
K0585401	ABM	3 x 1.0 ug	EUR 339

Derl3 sgRNA CRISPR Lentivector set (Rat)
K6111901	ABM	3 x 1.0 ug	EUR 339

Derl3 sgRNA CRISPR Lentivector set (Mouse)
K4041101	ABM	3 x 1.0 ug	EUR 339

Human Derlin 3(DERL3)ELISA Kit
QY-E04982	Qayee Biotechnology	96T	EUR 361

Polyclonal Derlin-3 / DERL3 Antibody (N-Terminus)
APR15724G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Derlin-3 / DERL3 (N-Terminus). This antibody is tested and proven to work in the following applications:

DERL3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0585402	ABM	1.0 ug DNA	EUR 154

DERL3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0585403	ABM	1.0 ug DNA	EUR 154

DERL3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0585404	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6111902	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6111903	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6111904	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4041102	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4041103	ABM	1.0 ug DNA	EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4041104	ABM	1.0 ug DNA	EUR 154

ELISA kit for Mouse Derlin-3 (DERL3)
KTE71307-48T	Abbkine	48T	EUR 332
The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)
KTE71307-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)
KTE71307-96T	Abbkine	96T	EUR 539
The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)
KTE10361-48T	Abbkine	48T	EUR 354
Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)
KTE10361-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)
KTE10361-96T	Abbkine	96T	EUR 572
Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL3 Protein Vector (Human) (pPB-C-His)
PV012229	ABM	500 ng	EUR 329

DERL3 Protein Vector (Human) (pPB-N-His)
PV012230	ABM	500 ng	EUR 329

DERL3 Protein Vector (Human) (pPM-C-HA)
PV012231	ABM	500 ng	EUR 329

DERL3 Protein Vector (Human) (pPM-C-His)
PV012232	ABM	500 ng	EUR 329

DERL3 Protein Vector (Mouse) (pPB-C-His)
PV171750	ABM	500 ng	EUR 603

DERL3 Protein Vector (Mouse) (pPB-N-His)
PV171751	ABM	500 ng	EUR 603

DERL3 Protein Vector (Mouse) (pPM-C-HA)
PV171752	ABM	500 ng	EUR 603

DERL3 Protein Vector (Mouse) (pPM-C-His)
PV171753	ABM	500 ng	EUR 603

DERL3 Protein Vector (Rat) (pPB-C-His)
PV263866	ABM	500 ng	EUR 603

DERL3 Protein Vector (Rat) (pPB-N-His)
PV263867	ABM	500 ng	EUR 603

DERL3 Protein Vector (Rat) (pPM-C-HA)
PV263868	ABM	500 ng	EUR 603

DERL3 Protein Vector (Rat) (pPM-C-His)
PV263869	ABM	500 ng	EUR 603

Derl3 3'UTR Luciferase Stable Cell Line
TU203354	ABM	1.0 ml	Ask for price

Derl3 3'UTR GFP Stable Cell Line
TU155082	ABM	1.0 ml	Ask for price

DERL3 3'UTR Luciferase Stable Cell Line
TU005834	ABM	1.0 ml	EUR 1521

Derl3 3'UTR Luciferase Stable Cell Line
TU105082	ABM	1.0 ml	Ask for price

DERL3 3'UTR GFP Stable Cell Line
TU055834	ABM	1.0 ml	EUR 1521

Derl3 3'UTR GFP Stable Cell Line
TU253354	ABM	1.0 ml	Ask for price

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0585405	ABM	3 x 1.0 ug	EUR 376

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6111905	ABM	3 x 1.0 ug	EUR 376

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4041105	ABM	3 x 1.0 ug	EUR 376

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0585406	ABM	1.0 ug DNA	EUR 167

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0585407	ABM	1.0 ug DNA	EUR 167

DERL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0585408	ABM	1.0 ug DNA	EUR 167

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6111906	ABM	1.0 ug DNA	EUR 167

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6111907	ABM	1.0 ug DNA	EUR 167

Derl3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6111908	ABM	1.0 ug DNA	EUR 167