dgka antibody

DGKA antibody

10R-8139 100 ug
EUR 457.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-8140 100 ug
EUR 457.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-6888 100 ul
EUR 726.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3825 100 ul
EUR 691.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3826 100 ul
EUR 691.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3827 100 ul
EUR 691.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3828 100 ul
EUR 691.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

10R-3830 100 ul
EUR 691.00
Description: Mouse monoclonal DGKA antibody

DGKA antibody

70R-31646 100 ug
EUR 327.00
Description: Rabbit polyclonal DGKA antibody

DGKA antibody

70R-5806 50 ug
EUR 467.00
Description: Rabbit polyclonal DGKA antibody raised against the N terminal of DGKA

DGKA Antibody

ABD3127 100 ug
EUR 438.00

DGKA Antibody

CSB-PA974220-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody

CSB-PA974220-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

DGKA Antibody

33723-100ul 100ul
EUR 252.00

DGKA Antibody

33723-50ul 50ul
EUR 187.00

DGKA antibody

70R-16810 50 ul
EUR 435.00
Description: Rabbit polyclonal DGKA antibody

DGKA Antibody

1-CSB-PA002124
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

DGKA Antibody

1-CSB-PA006832ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DGKA Antibody

1-CSB-PA006832GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DGKA. Recognizes DGKA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DGKA Antibody

DF3127 200ul
EUR 304.00
Description: DGKA Antibody detects endogenous levels of total DGKA.

DGKA Conjugated Antibody

C33723 100ul
EUR 397.00

Anti-DGKA antibody

PAab02356 100 ug
EUR 355.00

anti- DGKA antibody

FNab02356 100µg
EUR 505.25
  • Immunogen: diacylglycerol kinase, alpha 80kDa
  • Uniprot ID: P23743
  • Gene ID: 1606
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DGKA

Anti-DGKA antibody

STJ115904 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody

STJ23372 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Anti-DGKA antibody

STJ28976 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Several transcript variants encoding different isoforms have been identified for this gene.

Dgka/ Rat Dgka ELISA Kit

ELI-07745r 96 Tests
EUR 886.00

DGKA siRNA

20-abx901480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DGKA siRNA

20-abx914060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DGKA siRNA

20-abx914061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DGKA

YF-PA11276 50 ug
EUR 363.00
Description: Mouse polyclonal to DGKA

anti-DGKA

YF-PA11277 100 ug
EUR 403.00
Description: Rabbit polyclonal to DGKA

anti-DGKA

YF-PA27205 100 ul
EUR 403.00
Description: Rabbit polyclonal to DGKA

DGKA Blocking Peptide

33R-2431 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DGKA antibody, catalog no. 70R-5806

DGKA cloning plasmid

CSB-CL006832HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2208
  • Sequence: atggccaaggagaggggcctaataagccccagtgattttgcccagctgcaaaaatacatggaatactccaccaaaaaggtcagtgatgtcctaaagctcttcgaggatggcgagatggctaaatatgtccaaggagatgccattgggtacgagggattccagcaattcctgaaaa
  • Show more
Description: A cloning plasmid for the DGKA gene.

DGKA Blocking Peptide

DF3127-BP 1mg
EUR 195.00

Anti-DGKA (2B7)

YF-MA10227 100 ug
EUR 363.00
Description: Mouse monoclonal to DGKA

DGKA Rabbit pAb

A6896-100ul 100 ul
EUR 308.00

DGKA Rabbit pAb

A6896-200ul 200 ul
EUR 459.00

DGKA Rabbit pAb

A6896-20ul 20 ul
EUR 183.00

DGKA Rabbit pAb

A6896-50ul 50 ul
EUR 223.00

DGKA Rabbit pAb

A13969-100ul 100 ul
EUR 308.00

DGKA Rabbit pAb

A13969-200ul 200 ul
EUR 459.00

DGKA Rabbit pAb

A13969-20ul 20 ul
EUR 183.00

DGKA Rabbit pAb

A13969-50ul 50 ul
EUR 223.00

DGKA Rabbit pAb

A3824-100ul 100 ul
EUR 308.00

DGKA Rabbit pAb

A3824-200ul 200 ul
EUR 459.00

DGKA Rabbit pAb

A3824-20ul 20 ul Ask for price

DGKA Rabbit pAb

A3824-50ul 50 ul Ask for price

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx232356-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx013437
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx006850
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx033889-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx033889-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx036735-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx002774
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx321813
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx324527
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

abx330931-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody

20-abx130035
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diacylglycerol Kinase Alpha (DGKA) Antibody

20-abx112054
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diacylglycerol Kinase Alpha (DGKa) Antibody

20-abx102733
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal DGKA Antibody (C-term)

APR15728G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DGKA (C-term). This antibody is tested and proven to work in the following applications:

Human DGKA shRNA Plasmid

20-abx951129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DGKA ELISA KIT|Human

EF004859 96 Tests
EUR 689.00

Mouse DGKA shRNA Plasmid

20-abx969942
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DGKA shRNA Plasmid

20-abx987533
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DGKA Recombinant Protein (Human)

RP009211 100 ug Ask for price

DGKA Recombinant Protein (Mouse)

RP128864 100 ug Ask for price

DGKA Recombinant Protein (Rat)

RP197942 100 ug Ask for price