DYNC1I1

DYNC1I1 siRNA

20-abx901610
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1I1 siRNA

20-abx914799
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1I1 siRNA

20-abx914800
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DYNC1I1 antibody

70R-4124 50 ug
EUR 467.00
Description: Rabbit polyclonal DYNC1I1 antibody raised against the N terminal of DYNC1I1

DYNC1I1 antibody

70R-4125 50 ug
EUR 467.00
Description: Rabbit polyclonal DYNC1I1 antibody raised against the N terminal of DYNC1I1

DYNC1I1 antibody

70R-16963 50 ul
EUR 435.00
Description: Rabbit polyclonal DYNC1I1 antibody

DYNC1I1 Antibody

1-CSB-PA007293ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYNC1I1. Recognizes DYNC1I1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DYNC1I1 Antibody

1-CSB-PA007293ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYNC1I1. Recognizes DYNC1I1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DYNC1I1 Antibody

1-CSB-PA007293GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DYNC1I1. Recognizes DYNC1I1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DYNC1I1 Polyclonal Antibody

30494-100ul 100ul
EUR 252.00

DYNC1I1 Polyclonal Antibody

30494-50ul 50ul
EUR 187.00

DYNC1I1 Blocking Peptide

33R-3577 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNC1I1 antibody, catalog no. 70R-4125

DYNC1I1 Blocking Peptide

33R-4130 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DYNC1I1 antibody, catalog no. 70R-4124

DYNC1I1 cloning plasmid

CSB-CL007293HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1878
  • Sequence: atgtctgacaaaagtgacttaaaagctgagctagagcgcaaaaagcagcgcttagcacagataagagaagagaagaaacggaaggaagaggagaggaaaaagaaagaggctgatatgcagcagaagaaagaacccgttcaggacgactctgatctggatcgcaaacgacgagaga
  • Show more
Description: A cloning plasmid for the DYNC1I1 gene.

DYNC1I1 cloning plasmid

CSB-CL007293HU2-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1887
  • Sequence: atgtctgacaaaagtgacttaaaagctgagctagagcgcaaaaagcagcgcttagcacagataagagaagagaagaaacggaaggaagaggagaggaaaaagaaagaggctgatatgcagcagaagaaagaacccgttcaggacgactctgatctggatcgcaaacgacgagaga
  • Show more
Description: A cloning plasmid for the DYNC1I1 gene.

DYNC1I1 cloning plasmid

CSB-CL007293HU3-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1887
  • Sequence: atgtctgacaaaagtgacttaaaagctgagctagagcgcaaaaagcagcgcttagcacagataagagaagagaagaaacggaaggaagaggagaggaaaaagaaagaggctgatatgcagcagaagaaagaacccgttcaggacgactctgatctggatcgcaaacgacgagaga
  • Show more
Description: A cloning plasmid for the DYNC1I1 gene.

pBluescriptR-DYNC1I1 Plasmid

PVT16976 2 ug
EUR 325.00

Anti-DYNC1I1 antibody

PAab02583 100 ug
EUR 386.00

DYNC1I1 Rabbit pAb

A3833-100ul 100 ul
EUR 308.00

DYNC1I1 Rabbit pAb

A3833-200ul 200 ul
EUR 459.00

DYNC1I1 Rabbit pAb

A3833-20ul 20 ul
EUR 183.00

DYNC1I1 Rabbit pAb

A3833-50ul 50 ul
EUR 223.00

anti- DYNC1I1 antibody

FNab02583 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:20 - 1:200
  • Immunogen: dynein, cytoplasmic 1, intermediate chain 1
  • Uniprot ID: O14576
  • Gene ID: 1780
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against DYNC1I1

Anti-DYNC1I1 antibody

STJ23452 100 µl
EUR 277.00

Human DYNC1I1 shRNA Plasmid

20-abx951237
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Dync1i1 ELISA KIT

ELI-25845m 96 Tests
EUR 865.00

Human DYNC1I1 ELISA KIT

ELI-28132h 96 Tests
EUR 824.00

DYNC1I1 ELISA KIT|Human

EF009252 96 Tests
EUR 689.00

Bovine DYNC1I1 ELISA KIT

ELI-46697b 96 Tests
EUR 928.00

Mouse DYNC1I1 shRNA Plasmid

20-abx970030
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat DYNC1I1 shRNA Plasmid

20-abx985589
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DYNC1I1 Polyclonal Conjugated Antibody

C30494 100ul
EUR 397.00

DYNC1I1 Recombinant Protein (Human)

RP010009 100 ug Ask for price

DYNC1I1 Recombinant Protein (Human)

RP010012 100 ug Ask for price

DYNC1I1 Recombinant Protein (Human)

RP010015 100 ug Ask for price

DYNC1I1 Recombinant Protein (Mouse)

RP130373 100 ug Ask for price

DYNC1I1 Recombinant Protein (Mouse)

RP130376 100 ug Ask for price

DYNC1I1 Recombinant Protein (Mouse)

RP130379 100 ug Ask for price

DYNC1I1 Recombinant Protein (Mouse)

RP130382 100 ug Ask for price

DYNC1I1 Recombinant Protein (Mouse)

RP130385 100 ug Ask for price

DYNC1I1 Recombinant Protein (Rat)

RP198872 100 ug Ask for price

DYNC1I1 ORF Vector (Human) (pORF)

ORF003337 1.0 ug DNA
EUR 95.00

DYNC1I1 ORF Vector (Human) (pORF)

ORF003338 1.0 ug DNA
EUR 95.00

DYNC1I1 ORF Vector (Human) (pORF)

ORF003339 1.0 ug DNA
EUR 95.00

Dync1i1 ORF Vector (Rat) (pORF)

ORF066292 1.0 ug DNA
EUR 506.00

Dync1i1 ORF Vector (Mouse) (pORF)

ORF043459 1.0 ug DNA
EUR 506.00

Dync1i1 ORF Vector (Mouse) (pORF)

ORF043460 1.0 ug DNA
EUR 506.00

Dync1i1 ORF Vector (Mouse) (pORF)

ORF043461 1.0 ug DNA
EUR 506.00

Dync1i1 ORF Vector (Mouse) (pORF)

ORF043462 1.0 ug DNA
EUR 506.00

Dync1i1 ORF Vector (Mouse) (pORF)

ORF043463 1.0 ug DNA
EUR 506.00

Dync1i1 sgRNA CRISPR Lentivector set (Rat)

K6797901 3 x 1.0 ug
EUR 339.00

DYNC1I1 sgRNA CRISPR Lentivector set (Human)

K0643201 3 x 1.0 ug
EUR 339.00

Dync1i1 sgRNA CRISPR Lentivector set (Mouse)

K3704201 3 x 1.0 ug
EUR 339.00

Dync1i1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6797902 1.0 ug DNA
EUR 154.00

Dync1i1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6797903 1.0 ug DNA
EUR 154.00

Dync1i1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6797904 1.0 ug DNA
EUR 154.00

DYNC1I1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0643202 1.0 ug DNA
EUR 154.00

DYNC1I1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0643203 1.0 ug DNA
EUR 154.00

DYNC1I1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0643204 1.0 ug DNA
EUR 154.00

DYNC1I1 Protein Vector (Rat) (pPB-C-His)

PV265166 500 ng
EUR 603.00

DYNC1I1 Protein Vector (Rat) (pPB-N-His)

PV265167 500 ng
EUR 603.00

DYNC1I1 Protein Vector (Rat) (pPM-C-HA)

PV265168 500 ng
EUR 603.00

DYNC1I1 Protein Vector (Rat) (pPM-C-His)

PV265169 500 ng
EUR 603.00

DYNC1I1 3'UTR Luciferase Stable Cell Line

TU006453 1.0 ml
EUR 1394.00

DYNC1I1 3'UTR GFP Stable Cell Line

TU056453 1.0 ml
EUR 1394.00

Dync1i1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3704202 1.0 ug DNA
EUR 154.00

Dync1i1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3704203 1.0 ug DNA
EUR 154.00

Dync1i1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3704204 1.0 ug DNA
EUR 154.00

DYNC1I1 Protein Vector (Mouse) (pPB-C-His)

PV173834 500 ng
EUR 603.00

DYNC1I1 Protein Vector (Mouse) (pPB-N-His)

PV173835 500 ng
EUR 603.00