EDEM2

EDEM2 Antibody

40055-100ul 100ul
EUR 390.00

EDEM2 Antibody

46557-100ul 100ul
EUR 252.00

EDEM2 Antibody

ABD9503 100 ug
EUR 438.00

EDEM2 Antibody

1-CSB-PA861146LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EDEM2 Antibody

6633-100
EUR 349.00

EDEM2 Antibody

6633-30T
EUR 146.00

EDEM2 Antibody

1-CSB-PA030228
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

pOTB7-EDEM2

PVT18710 2 ug
EUR 231.00

anti-EDEM2

YF-PA19809 50 ul
EUR 363.00
Description: Mouse polyclonal to EDEM2

anti-EDEM2

YF-PA19810 100 ug
EUR 403.00
Description: Rabbit polyclonal to EDEM2

EDEM2 Antibody

DF9503 200ul
EUR 304.00
Description: EDEM2 Antibody detects endogenous levels of total EDEM2.

EDEM2 Polyclonal Antibody

ABP55756-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

ABP55756-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human EDEM2
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM2 from Human. This EDEM2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human EDEM2

EDEM2 Polyclonal Antibody

A58890 100 µg
EUR 570.55
Description: kits suitable for this type of research

EDEM2 Polyclonal Antibody

ES6755-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Polyclonal Antibody

ES6755-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against EDEM2 from Human. This antibody is tested and validated for IHC, WB, ELISA

EDEM2 Conjugated Antibody

C46557 100ul
EUR 397.00

EDEM2 Blocking Peptide

6633BP-50
EUR 153.00

EDEM2 cloning plasmid

CSB-CL861146HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atgcctttccggctgctcatcccgctcggcctcctgtgcgcgctgctgcctcagcaccatggtgcgccaggtcccgacggctccgcgccagatcccgcccactacagggagcgagtcaaggccatgttctaccacgcctacgacagctacctggagaatgcctttcccttcgatg
  • Show more
Description: A cloning plasmid for the EDEM2 gene.

Anti-EDEM2 (2E4)

YF-MA11569 100 ug
EUR 363.00
Description: Mouse monoclonal to EDEM2

Anti-EDEM2 antibody

PAab02632 100 ug
EUR 355.00

EDEM2 Blocking Peptide

DF9503-BP 1mg
EUR 195.00

anti- EDEM2 antibody

FNab02632 100µg
EUR 505.25
  • Immunogen: ER degradation enhancer, mannosidase alpha-like 2
  • Uniprot ID: Q9BV94
  • Gene ID: 55741
  • Research Area: Metabolism
Description: Antibody raised against EDEM2

Polyclonal EDEM2 Antibody

AMM07003G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM2 . This antibody is tested and proven to work in the following applications:

Anti-EDEM2 antibody

STJ92823 200 µl
EUR 197.00
Description: Rabbit polyclonal to EDEM2.

EDEM2 Antibody, HRP conjugated

1-CSB-PA861146LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EDEM2 Antibody, FITC conjugated

1-CSB-PA861146LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EDEM2 Antibody, Biotin conjugated

1-CSB-PA861146LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDEM2. Recognizes EDEM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human EDEM2 ELISA KIT

ELI-32317h 96 Tests
EUR 824.00

EDEM2 ELISA KIT|Human

EF009290 96 Tests
EUR 689.00

Human EDEM2 shRNA Plasmid

20-abx960878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EDEM2 Recombinant Protein (Human)

RP010159 100 ug Ask for price

EDEM2 Recombinant Protein (Mouse)

RP130856 100 ug Ask for price

EDEM2 Recombinant Protein (Rat)

RP199049 100 ug Ask for price

EDEM2 Polyclonal Antibody, Biotin Conjugated

A58891 100 µg
EUR 570.55
Description: fast delivery possible

EDEM2 Polyclonal Antibody, FITC Conjugated

A58892 100 µg
EUR 570.55
Description: reagents widely cited

EDEM2 Polyclonal Antibody, HRP Conjugated

A58893 100 µg
EUR 570.55
Description: Ask the seller for details

EDEM2 ORF Vector (Human) (pORF)

ORF003387 1.0 ug DNA
EUR 95.00

Edem2 ORF Vector (Rat) (pORF)

ORF066351 1.0 ug DNA
EUR 506.00

Edem2 ORF Vector (Mouse) (pORF)

ORF043620 1.0 ug DNA
EUR 506.00

Edem2 sgRNA CRISPR Lentivector set (Mouse)

K3235601 3 x 1.0 ug
EUR 339.00

Edem2 sgRNA CRISPR Lentivector set (Rat)

K7428201 3 x 1.0 ug
EUR 339.00

EDEM2 sgRNA CRISPR Lentivector set (Human)

K0653501 3 x 1.0 ug
EUR 339.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3235602 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3235603 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3235604 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7428202 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7428203 1.0 ug DNA
EUR 154.00

Edem2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7428204 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653502 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653503 1.0 ug DNA
EUR 154.00

EDEM2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653504 1.0 ug DNA
EUR 154.00

EDEM2 Protein Vector (Rat) (pPB-C-His)

PV265402 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPB-N-His)

PV265403 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPM-C-HA)

PV265404 500 ng
EUR 603.00

EDEM2 Protein Vector (Rat) (pPM-C-His)

PV265405 500 ng
EUR 603.00

EDEM2 3'UTR Luciferase Stable Cell Line

TU006560 1.0 ml
EUR 1394.00

EDEM2 3'UTR GFP Stable Cell Line

TU056560 1.0 ml
EUR 1394.00

EDEM2 Protein Vector (Mouse) (pPB-C-His)

PV174478 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPB-N-His)

PV174479 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPM-C-HA)

PV174480 500 ng
EUR 603.00

EDEM2 Protein Vector (Mouse) (pPM-C-His)

PV174481 500 ng
EUR 603.00

Edem2 3'UTR GFP Stable Cell Line

TU155598 1.0 ml Ask for price

Edem2 3'UTR GFP Stable Cell Line

TU253777 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU203777 1.0 ml Ask for price

Edem2 3'UTR Luciferase Stable Cell Line

TU105598 1.0 ml Ask for price

EDEM2 Protein Vector (Human) (pPB-C-His)

PV013545 500 ng
EUR 329.00

EDEM2 Protein Vector (Human) (pPB-N-His)

PV013546 500 ng
EUR 329.00

EDEM2 Protein Vector (Human) (pPM-C-HA)

PV013547 500 ng
EUR 329.00