F8

Canine Coagulation Factor VIII (F8) ELISA Kit

DL-F8-c-48 1 kit of 48 tests
EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit

DL-F8-c-96 1 kit of 96 tests
EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Canine Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-192 1 kit of 192 tests
EUR 1103.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-48 1 kit of 48 tests
EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Human Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Hu-96 1 kit of 96 tests
EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Mouse Coagulation Factor VIII (F8) ELISA Kit

DL-F8-Mu-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Coagulation Factor VIII (F8)

Canine Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-c-48T 48T
EUR 549.00
  • Should the Canine Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Coagulation Factor VIII (F8) in samples from plasma or other biological fluids.

Canine Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-c-96T 96T
EUR 718.00
  • Should the Canine Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine Coagulation Factor VIII (F8) in samples from plasma or other biological fluids.

Human Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Hu-48T 48T
EUR 498.00
  • Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Human Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Hu-96T 96T
EUR 647.00
  • Should the Human Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Mu-48T 48T
EUR 508.00
  • Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Mouse Coagulation Factor VIII (F8) ELISA Kit

DLR-F8-Mu-96T 96T
EUR 661.00
  • Should the Mouse Coagulation Factor VIII (F8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Coagulation Factor VIII (F8) in samples from plasma.

Canine Coagulation Factor VIII (F8) ELISA Kit

RD-F8-c-48Tests 48 Tests
EUR 557.00

Canine Coagulation Factor VIII (F8) ELISA Kit

RD-F8-c-96Tests 96 Tests
EUR 775.00

Human Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Hu-48Tests 48 Tests
EUR 500.00

Human Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Hu-96Tests 96 Tests
EUR 692.00

Mouse Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Mu-48Tests 48 Tests
EUR 511.00

Mouse Coagulation Factor VIII (F8) ELISA Kit

RD-F8-Mu-96Tests 96 Tests
EUR 709.00

Canine Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-c-48Tests 48 Tests
EUR 583.00

Canine Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-c-96Tests 96 Tests
EUR 811.00

Human Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Hu-48Tests 48 Tests
EUR 522.00

Human Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Hu-96Tests 96 Tests
EUR 724.00

Mouse Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Mu-48Tests 48 Tests
EUR 534.00

Mouse Coagulation Factor VIII (F8) ELISA Kit

RDR-F8-Mu-96Tests 96 Tests
EUR 742.00

F8 Antibody

1-CSB-PA007932GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: liquid
  • Buffer: PBS with 0.1% sodium azide and 50% glycerol pH 7.3. Antigen Affinity Purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF

F8 Antibody

1-CSB-PA007932LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

F8 antibody

38232-100ul 100ul
EUR 252.00

F8 antibody

70R-9971 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal F8 antibody

F8 Antibody

ABD6397 100 ug
EUR 438.00

F8 siRNA

20-abx915892
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F8 siRNA

20-abx915893
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

F8 Antibody

1-CSB-PA002462
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against F8. Recognizes F8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

pCDNA4- F8

PVT10395 2 ug
EUR 405.00

pENTR223- F8

PVT11401 2 ug
EUR 273.00

F8 Conjugated Antibody

C38232 100ul
EUR 397.00

F8 Polyclonal Antibody

A62534 100 µg
EUR 570.55
Description: kits suitable for this type of research

F8 cloning plasmid

CSB-CL007932HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 651
  • Sequence: atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcag
  • Show more
Description: A cloning plasmid for the F8 gene.

F8 Blocking Peptide

33R-3569 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of F8 antibody, catalog no. 70R-9971

anti-F8 (5E9B2)

LF-MA30229 100 ul
EUR 486.00
Description: Mouse Monoclonal to F8

Anti-F8 antibody

STJ23600 100 µl
EUR 277.00
Description: This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder.

F8 Antibody, HRP conjugated

1-CSB-PA007932LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

F8 Antibody, FITC conjugated

1-CSB-PA007932LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

F8 Antibody, Biotin conjugated

1-CSB-PA007932LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against F8. Recognizes F8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse F8 shRNA Plasmid

20-abx970267
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Factor VIII (F8) Antibody

20-abx009278
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Factor VIII (F8) Antibody

abx022383-1ml 1 ml
EUR 878.00
  • Shipped within 5-10 working days.

Factor VIII (F8) Antibody

abx022384-02mg 0.2 mg
EUR 676.00
  • Shipped within 5-10 working days.

Human F8 shRNA Plasmid

20-abx951499
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

F8 ELISA KIT|Human

EF001353 96 Tests
EUR 689.00

Human F8 ELISA Kit

ELA-E0841h 96 Tests
EUR 824.00

Canine F8 ELISA KIT

ELI-02861d 96 Tests
EUR 928.00

pECMV-3-FLAG-F8

PVT13357 2 ug
EUR 599.00

Anti-BMP7 (M1-F8)

YF-MA10098 100 ug
EUR 363.00
Description: Mouse monoclonal to BMP7

Anti-GRLF1 (4D4-F8)

YF-MA13331 100 ug
EUR 363.00
Description: Mouse monoclonal to GRLF1

EasyComp Fluorescent Particles

ECFP-F8 mL
EUR 182.00
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

Monoclonal ACTA1 / ASMA Antibody (clone 5C5.F8.C7), Clone: 5C5.F8.C7

AMM01963G 0.05mg
EUR 484.00
Description: A Monoclonal antibody against Human ACTA1 / ASMA (clone 5C5.F8.C7). The antibodies are raised in Mouse and are from clone 5C5.F8.C7. This antibody is applicable in IHC-P, IF

F8 Polyclonal Antibody, HRP Conjugated

A62535 100 µg
EUR 570.55
Description: fast delivery possible

F8 Polyclonal Antibody, FITC Conjugated

A62536 100 µg
EUR 570.55
Description: reagents widely cited

F8 Polyclonal Antibody, Biotin Conjugated

A62537 100 µg
EUR 570.55
Description: Ask the seller for details

Coagulation Factor VIII (F8) Antibody

20-abx001205
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

20-abx102111
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

20-abx102112
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody

20-abx102113
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

20-abx102114
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Coagulation Factor VIII (F8) Antibody

20-abx102115
  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coagulation Factor VIII (F8) Antibody

20-abx111706
  • EUR 996.00
  • EUR 551.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

20-abx325763
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coagulation Factor VIII (F8) Antibody

20-abx301929
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.