FBXO4

FBXO4 antibody
70R-2792 50 ug
EUR 467.00
Description: Rabbit polyclonal FBXO4 antibody raised against the middle region of FBXO4

FBXO4 Antibody
1-CSB-PA891538ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO4. Recognizes FBXO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

FBXO4 Antibody
1-CSB-PA891538ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO4. Recognizes FBXO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

FBXO4 siRNA
20-abx916646
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

FBXO4 siRNA
20-abx916647
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pBluescriptR-FBXO4
PVT17777 2 ug
EUR 231.00

anti-FBXO4
YF-PA18274 50 ul
EUR 363.00
Description: Mouse polyclonal to FBXO4

anti-FBXO4
YF-PA18275 50 ug
EUR 363.00
Description: Mouse polyclonal to FBXO4

anti-FBXO4
YF-PA18276 100 ul
EUR 403.00
Description: Rabbit polyclonal to FBXO4

anti-FBXO4
YF-PA18277 100 ug
EUR 403.00
Description: Rabbit polyclonal to FBXO4

Anti-FBXO4 Antibody
A08044 100uL
EUR 455.00
Description: Rabbit Polyclonal FBXO4 Antibody. Validated in WB and tested in Human, Mouse.

FBXO4 Blocking Peptide
33R-4632 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO4 antibody, catalog no. 70R-2792

FBXO4 Blocking Peptide
33R-9277 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO4 antibody, catalog no. 70R-2791

FBXO4 Polyclonal Antibody
31789-100ul 100ul
EUR 252.00

FBXO4 Polyclonal Antibody
31789-50ul 50ul
EUR 187.00

FBXO4 cloning plasmid
CSB-CL891538HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atggcgggaagcgagccgcgcagcggaacaaactcgccgccgccgcccttcagcgactggggccgcctggaggcggccatcctcagcggctggaagaccttctggcagtcagtgagcaaggagagggtggcgcgtacgacctcacgggaggaggtggatgaggcggccagcaccc
  • Show more
Description: A cloning plasmid for the FBXO4 gene.

FBXO4 Rabbit pAb
A9968-100ul 100 ul
EUR 308.00

FBXO4 Rabbit pAb
A9968-200ul 200 ul
EUR 459.00

FBXO4 Rabbit pAb
A9968-20ul 20 ul
EUR 183.00

FBXO4 Rabbit pAb
A9968-50ul 50 ul
EUR 223.00

Anti-FBXO4 antibody
STJ112009 100 µl
EUR 277.00
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-FBXO4 antibody
STJ72184 100 µg
EUR 359.00

Anti-FBXO4 antibody
STJ72185 100 µg
EUR 359.00

Anti-FBXO4 (2F2)
YF-MA18090 100 ug
EUR 363.00
Description: Mouse monoclonal to FBXO4

FBXO4 Polyclonal Conjugated Antibody
C31789 100ul
EUR 397.00

Polyclonal FBXO4 Antibody (Center)
APR06157G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXO4 (Center). This antibody is tested and proven to work in the following applications:

Human FBXO4 shRNA Plasmid
20-abx958795
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse FBXO4 shRNA Plasmid
20-abx979729
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

FBXO4 Recombinant Protein (Human)
RP011923 100 ug Ask for price

FBXO4 Recombinant Protein (Rat)
RP201035 100 ug Ask for price

FBXO4 Recombinant Protein (Mouse)
RP134024 100 ug Ask for price

Polyclonal FBXO4 Antibody (internal region)
APG00659G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal FBXO4 Antibody (internal region)
APG00660G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal FBXO4 / FBX4 Antibody (Internal)
APG01165G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 / FBX4 (Internal). This antibody is tested and proven to work in the following applications:

Fbxo4 ORF Vector (Rat) (pORF)
ORF067013 1.0 ug DNA
EUR 506.00

FBXO4 ORF Vector (Human) (pORF)
ORF003975 1.0 ug DNA
EUR 95.00

Fbxo4 ORF Vector (Mouse) (pORF)
ORF044676 1.0 ug DNA
EUR 506.00

Fbxo4 sgRNA CRISPR Lentivector set (Rat)
K6615801 3 x 1.0 ug
EUR 339.00

FBXO4 sgRNA CRISPR Lentivector set (Human)
K0763701 3 x 1.0 ug
EUR 339.00

Fbxo4 sgRNA CRISPR Lentivector set (Mouse)
K3869901 3 x 1.0 ug
EUR 339.00

F-Box Only Protein 4 (FBXO4) Antibody
20-abx135888
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
abx145812-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
abx034312-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
abx034312-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
20-abx321367
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
20-abx321400
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody
abx431024-200ul 200 ul
EUR 286.00
  • Shipped within 1-3 working days.

F-Box Only Protein 4 (FBXO4) Antibody
abx431025-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6615802 1.0 ug DNA
EUR 154.00

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6615803 1.0 ug DNA
EUR 154.00

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6615804 1.0 ug DNA
EUR 154.00

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0763702 1.0 ug DNA
EUR 154.00

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0763703 1.0 ug DNA
EUR 154.00

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0763704 1.0 ug DNA
EUR 154.00

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3869902 1.0 ug DNA
EUR 154.00

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3869903 1.0 ug DNA
EUR 154.00

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3869904 1.0 ug DNA
EUR 154.00

FBXO4 Protein Vector (Mouse) (pPB-C-His)
PV178702 500 ng
EUR 603.00

FBXO4 Protein Vector (Mouse) (pPB-N-His)
PV178703 500 ng
EUR 603.00

FBXO4 Protein Vector (Mouse) (pPM-C-HA)
PV178704 500 ng
EUR 603.00

FBXO4 Protein Vector (Mouse) (pPM-C-His)
PV178705 500 ng
EUR 603.00

FBXO4 Protein Vector (Rat) (pPB-C-His)
PV268050 500 ng
EUR 603.00

FBXO4 Protein Vector (Rat) (pPB-N-His)
PV268051 500 ng
EUR 603.00

FBXO4 Protein Vector (Rat) (pPM-C-HA)
PV268052 500 ng
EUR 603.00

FBXO4 Protein Vector (Rat) (pPM-C-His)
PV268053 500 ng
EUR 603.00

FBXO4 Protein Vector (Human) (pPB-C-His)
PV015897 500 ng
EUR 329.00

FBXO4 Protein Vector (Human) (pPB-N-His)
PV015898 500 ng
EUR 329.00

FBXO4 Protein Vector (Human) (pPM-C-HA)
PV015899 500 ng
EUR 329.00

FBXO4 Protein Vector (Human) (pPM-C-His)
PV015900 500 ng
EUR 329.00

Fbxo4 3'UTR GFP Stable Cell Line
TU156431 1.0 ml Ask for price