FBXO4

FBXO4 siRNA

20-abx916647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXO4 antibody

70R-2791 50 ug
EUR 467
Description: Rabbit polyclonal FBXO4 antibody raised against the middle region of FBXO4

FBXO4 antibody

70R-2792 50 ug
EUR 467
Description: Rabbit polyclonal FBXO4 antibody raised against the middle region of FBXO4

FBXO4 Antibody

1-CSB-PA891538ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO4. Recognizes FBXO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

FBXO4 Antibody

1-CSB-PA891538ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FBXO4. Recognizes FBXO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

pBluescriptR-FBXO4

PVT17777 2 ug
EUR 231

anti-FBXO4

YF-PA18274 50 ul
EUR 363
Description: Mouse polyclonal to FBXO4

anti-FBXO4

YF-PA18275 50 ug
EUR 363
Description: Mouse polyclonal to FBXO4

anti-FBXO4

YF-PA18276 100 ul
EUR 403
Description: Rabbit polyclonal to FBXO4

anti-FBXO4

YF-PA18277 100 ug
EUR 403
Description: Rabbit polyclonal to FBXO4

Anti-FBXO4 Antibody

A08044 100uL
EUR 455
Description: Rabbit Polyclonal FBXO4 Antibody. Validated in WB and tested in Human, Mouse.

FBXO4 Rabbit pAb

A9968-100ul 100 ul
EUR 308

FBXO4 Rabbit pAb

A9968-200ul 200 ul
EUR 459

FBXO4 Rabbit pAb

A9968-20ul 20 ul
EUR 183

FBXO4 Rabbit pAb

A9968-50ul 50 ul
EUR 223

FBXO4 Blocking Peptide

33R-4632 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO4 antibody, catalog no. 70R-2792

FBXO4 Blocking Peptide

33R-9277 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXO4 antibody, catalog no. 70R-2791

FBXO4 Polyclonal Antibody

31789-100ul 100ul
EUR 252

FBXO4 Polyclonal Antibody

31789-50ul 50ul
EUR 187

FBXO4 cloning plasmid

CSB-CL891538HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atggcgggaagcgagccgcgcagcggaacaaactcgccgccgccgcccttcagcgactggggccgcctggaggcggccatcctcagcggctggaagaccttctggcagtcagtgagcaaggagagggtggcgcgtacgacctcacgggaggaggtggatgaggcggccagcaccc
  • Show more
Description: A cloning plasmid for the FBXO4 gene.

Anti-FBXO4 antibody

STJ72184 100 µg
EUR 359

Anti-FBXO4 antibody

STJ72185 100 µg
EUR 359

Anti-FBXO4 antibody

STJ112009 100 µl
EUR 277
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-FBXO4 (2F2)

YF-MA18090 100 ug
EUR 363
Description: Mouse monoclonal to FBXO4

Polyclonal FBXO4 Antibody (Center)

APR06157G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXO4 (Center). This antibody is tested and proven to work in the following applications:

FBXO4 Polyclonal Conjugated Antibody

C31789 100ul
EUR 397

Mouse FBXO4 shRNA Plasmid

20-abx979729
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBXO4 shRNA Plasmid

20-abx958795
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXO4 Recombinant Protein (Human)

RP011923 100 ug Ask for price

FBXO4 Recombinant Protein (Rat)

RP201035 100 ug Ask for price

FBXO4 Recombinant Protein (Mouse)

RP134024 100 ug Ask for price

Polyclonal FBXO4 Antibody (internal region)

APG00659G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal FBXO4 Antibody (internal region)

APG00660G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal FBXO4 / FBX4 Antibody (Internal)

APG01165G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FBXO4 / FBX4 (Internal). This antibody is tested and proven to work in the following applications:

FBXO4 ORF Vector (Human) (pORF)

ORF003975 1.0 ug DNA
EUR 95

Fbxo4 ORF Vector (Rat) (pORF)

ORF067013 1.0 ug DNA
EUR 506

Fbxo4 ORF Vector (Mouse) (pORF)

ORF044676 1.0 ug DNA
EUR 506

FBXO4 sgRNA CRISPR Lentivector set (Human)

K0763701 3 x 1.0 ug
EUR 339

Fbxo4 sgRNA CRISPR Lentivector set (Mouse)

K3869901 3 x 1.0 ug
EUR 339

Fbxo4 sgRNA CRISPR Lentivector set (Rat)

K6615801 3 x 1.0 ug
EUR 339

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0763702 1.0 ug DNA
EUR 154

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0763703 1.0 ug DNA
EUR 154

FBXO4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0763704 1.0 ug DNA
EUR 154

F-Box Only Protein 4 (FBXO4) Antibody

abx145812-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

20-abx135888
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

abx034312-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

abx034312-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

20-abx321367
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

20-abx321400
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box Only Protein 4 (FBXO4) Antibody

abx431024-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

F-Box Only Protein 4 (FBXO4) Antibody

abx431025-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3869902 1.0 ug DNA
EUR 154

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3869903 1.0 ug DNA
EUR 154

Fbxo4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3869904 1.0 ug DNA
EUR 154

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6615802 1.0 ug DNA
EUR 154

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6615803 1.0 ug DNA
EUR 154

Fbxo4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6615804 1.0 ug DNA
EUR 154

FBXO4 Protein Vector (Mouse) (pPB-C-His)

PV178702 500 ng
EUR 603

FBXO4 Protein Vector (Mouse) (pPB-N-His)

PV178703 500 ng
EUR 603

FBXO4 Protein Vector (Mouse) (pPM-C-HA)

PV178704 500 ng
EUR 603

FBXO4 Protein Vector (Mouse) (pPM-C-His)

PV178705 500 ng
EUR 603

FBXO4 Protein Vector (Human) (pPB-C-His)

PV015897 500 ng
EUR 329

FBXO4 Protein Vector (Human) (pPB-N-His)

PV015898 500 ng
EUR 329

FBXO4 Protein Vector (Human) (pPM-C-HA)

PV015899 500 ng
EUR 329

FBXO4 Protein Vector (Human) (pPM-C-His)

PV015900 500 ng
EUR 329

FBXO4 Protein Vector (Rat) (pPB-C-His)

PV268050 500 ng
EUR 603

FBXO4 Protein Vector (Rat) (pPB-N-His)

PV268051 500 ng
EUR 603

FBXO4 Protein Vector (Rat) (pPM-C-HA)

PV268052 500 ng
EUR 603

FBXO4 Protein Vector (Rat) (pPM-C-His)

PV268053 500 ng
EUR 603

Fbxo4 3'UTR Luciferase Stable Cell Line

TU204514 1.0 ml Ask for price