foxo4 peptide

FoxO4 Blocking Peptide

AF7841-BP 1mg
EUR 195.00

FOXO4 Blocking Peptide

AF6369-BP 1mg
EUR 195.00

FOXO4 (pS197) Blocking Peptide

20-abx062937
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FOXO4 (pT451) Blocking Peptide

20-abx062938
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Phospho-FoxO4 (Ser197) Blocking Peptide

AF7341-BP 1mg
EUR 195.00

Phospho-FOXO4 (Thr451) Blocking Peptide

AF3369-BP 1mg
EUR 195.00

FOXO4 siRNA

20-abx917151
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FOXO4 siRNA

20-abx917152
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FOXO4 Antibody

25139-100ul 100ul
EUR 390.00

FOXO4 Antibody

25140-100ul 100ul
EUR 390.00

FOXO4 Antibody

49179-100ul 100ul
EUR 333.00

FOXO4 Antibody

49179-50ul 50ul
EUR 239.00

FOXO4 Antibody

49279-100ul 100ul
EUR 333.00

FOXO4 Antibody

49279-50ul 50ul
EUR 239.00

FOXO4 Antibody

43669-100ul 100ul
EUR 252.00

FOXO4 antibody

70R-50062 100 ul
EUR 287.00
Description: Purified Polyclonal FOXO4 antibody

FOXO4 antibody

70R-50063 100 ul
EUR 287.00
Description: Purified Polyclonal FOXO4 antibody

FOXO4 antibody

70R-50064 100 ul
EUR 244.00
Description: Purified Polyclonal FOXO4 antibody

FOXO4 antibody

70R-36190 100 ug
EUR 327.00
Description: Rabbit polyclonal FOXO4 antibody

FOXO4 Antibody

ABF6369 100 ug
EUR 438.00

FOXO4 Antibody

1-CSB-PA010207
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

FOXO4 Antibody

1-CSB-PA008839GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FOXO4 Antibody

1-CSB-PA008839OA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

FOXO4 Antibody

1-CSB-PA002575
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

FOXO4 Antibody

1-CSB-PA002576
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

FOXO4 antibody

70R-17348 50 ul
EUR 435.00
Description: Rabbit polyclonal FOXO4 antibody

FOXO4 Antibody

1-CSB-PA277767
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXO4. Recognizes FOXO4 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

FOXO4 Antibody

AF6369 200ul
EUR 304.00
Description: FOXO4 Antibody detects endogenous levels of total FOXO4.

FoxO4 Antibody

AF7841 200ul
EUR 376.00
Description: FoxO4 Antibody detects endogenous levels of FoxO4.

FOXO4 (pT451) Antibody

20-abx009778
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

FOXO4 (pS197) Antibody

20-abx009779
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

FOXO4 (pT451) Antibody

abx010799-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

FOXO4 (pT451) Antibody

abx333041-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

FOXO4 antibody (Thr451)

70R-35842 100 ug
EUR 327.00
Description: Rabbit polyclonal FOXO4 antibody (Thr451)

FOXO4 antibody (Ser262)

70R-32602 100 ug
EUR 327.00
Description: Rabbit polyclonal FOXO4 antibody (Ser262)

FoxO4 Polyclonal Antibody

ABP55260-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262

FoxO4 Polyclonal Antibody

ABP55260-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262

FoxO4 Polyclonal Antibody

ABP55260-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S262

FoxO4 Polyclonal Antibody

ABP51368-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse, Monkey. This FoxO4 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451

FoxO4 Polyclonal Antibody

ABP51368-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse, Monkey. This FoxO4 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451

FoxO4 Polyclonal Antibody

ABP51368-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse, Monkey. This FoxO4 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of T451

FoxO4 Polyclonal Antibody

ABP51369-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197

FoxO4 Polyclonal Antibody

ABP51369-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197

FoxO4 Polyclonal Antibody

ABP51369-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human, Mouse. This FoxO4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FoxO4 around the non-phosphorylation site of S197

FoxO4 Polyclonal Antibody

ABP58590-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200

FoxO4 Polyclonal Antibody

ABP58590-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200

FoxO4 Polyclonal Antibody

ABP58590-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200
  • Applications tips:
Description: A polyclonal antibody for detection of FoxO4 from Human. This FoxO4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FoxO4 protein at amino acid sequence of 170-200

FOXO4 (pS197) Antibody

20-abx000229
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

FOXO4 Polyclonal Antibody

E-AB-36443-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human FOXO4 for WB,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-36443-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human FOXO4 for WB,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-36443-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human FOXO4 for WB,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31470-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse,Monkey FOXO4 for WB,IF,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31470-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse,Monkey FOXO4 for WB,IF,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31470-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse,Monkey FOXO4 for WB,IF,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31471-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse FOXO4 for WB,IHC-p,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31471-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse FOXO4 for WB,IHC-p,ELISA applications.

FOXO4 Polyclonal Antibody

E-AB-31471-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: Transcription factor involved in the regulation of the insulin signaling pathway. Binds to i
  • Show more
Description: Rabbit antibody against Human,Mouse FOXO4 for WB,IHC-p,ELISA applications.

FoxO4 Polyclonal Antibody

ES8824-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against FoxO4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FoxO4 Polyclonal Antibody

ES8824-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against FoxO4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FoxO4 Polyclonal Antibody

ES6259-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against FoxO4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FoxO4 Polyclonal Antibody

ES6259-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against FoxO4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FOXO4 Polyclonal Antibody

ES2367-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against FOXO4 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

FOXO4 Polyclonal Antibody

ES2367-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against FOXO4 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

FOXO4 Polyclonal Antibody

ES2368-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against FOXO4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FOXO4 Polyclonal Antibody

ES2368-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against FOXO4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FOXO4 Conjugated Antibody

C49179 100ul
EUR 397.00

FOXO4 Conjugated Antibody

C43669 100ul
EUR 397.00

FOXO4 cloning plasmid

CSB-CL008839HU-10ug 10ug
EUR 535.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: ATGGATCCGGGGAATGAGAATTCAGCCACAGAGGCTGCCGCGATCATAGACCTAGATCCCGACTTCGAACCCCAGAGCCGTCCCCGCTCCTGCACCTGGCCCCTTCCCCGACCAGAGATCGCTAACCAGCCGTCCGAGCCGCCCGAGGTGGAGCCAGATCTGGGGGAAAAGGTAC
  • Show more
Description: A cloning plasmid for the FOXO4 gene.

Anti-FOXO4 antibody

PAab03203 100 ug
EUR 386.00

Anti-FOXO4 antibody

PAab03204 100 ug
EUR 355.00