GALNT1 Antibody

abx145974-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA11924 50 ug
EUR 363.00
Description: Mouse polyclonal to GALNT1


YF-PA23757 50 ul
EUR 334.00
Description: Mouse polyclonal to GALNT1

GALNT1 cloning plasmid

CSB-CL607410HU1-10ug 10ug
EUR 199.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 318
  • Sequence: atgagaaaatttgcatactgcaaggtggtcctagccacctccttgatttgggtactcttggatatgttcctgctgctttacttcagtgaatgcaacaaatgtgatgaaaaaaaggagagaggacttcctgctggagatgttctagagccagtacaaaagcctcatgaaggtcctgg
  • Show more
Description: A cloning plasmid for the GALNT1 gene.

GALNT1 cloning plasmid

CSB-CL607410HU2-10ug 10ug
EUR 530.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1500
  • Show more
Description: A cloning plasmid for the GALNT1 gene.

Anti-GALNT1 (3C10)

YF-MA13180 100 ug
EUR 363.00
Description: Mouse monoclonal to GALNT1

Rat GALNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GALNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GALNT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GALNT1 Recombinant Protein (Human)

RP012862 100 ug Ask for price

GALNT1 Recombinant Protein (Human)

RP039382 100 ug Ask for price

GALNT1 Recombinant Protein (Rat)

RP202154 100 ug Ask for price

GALNT1 Recombinant Protein (Mouse)

RP135809 100 ug Ask for price

GALNT1 Recombinant Protein (Mouse)

RP135812 100 ug Ask for price

GALNT1 ORF Vector (Human) (pORF)

ORF004288 1.0 ug DNA
EUR 95.00

Galnt1 ORF Vector (Rat) (pORF)

ORF067386 1.0 ug DNA
EUR 506.00

Galnt1 ORF Vector (Mouse) (pORF)

ORF045271 1.0 ug DNA
EUR 506.00

Galnt1 ORF Vector (Mouse) (pORF)

ORF045272 1.0 ug DNA
EUR 506.00

GALNT1 ORF Vector (Human) (pORF)

ORF013128 1.0 ug DNA
EUR 354.00

Porcine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1

ELI-07931p 96 Tests
EUR 928.00

Bovine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1

ELI-27199b 96 Tests
EUR 928.00

Galnt1 sgRNA CRISPR Lentivector set (Mouse)

K3758501 3 x 1.0 ug
EUR 339.00

GALNT1 sgRNA CRISPR Lentivector set (Human)

K0835101 3 x 1.0 ug
EUR 339.00

Galnt1 sgRNA CRISPR Lentivector set (Rat)

K7020501 3 x 1.0 ug
EUR 339.00

Rat Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 ELI

ELI-21419r 96 Tests
EUR 886.00

Human Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1 E

ELI-30795h 96 Tests
EUR 824.00

Mouse Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 E

ELI-30946m 96 Tests
EUR 865.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3758502 1.0 ug DNA
EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3758503 1.0 ug DNA
EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3758504 1.0 ug DNA
EUR 154.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835102 1.0 ug DNA
EUR 154.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835103 1.0 ug DNA
EUR 154.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835104 1.0 ug DNA
EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7020502 1.0 ug DNA
EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7020503 1.0 ug DNA
EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7020504 1.0 ug DNA
EUR 154.00

GALNT1 Protein Vector (Human) (pPB-C-His)

PV052509 500 ng
EUR 481.00

GALNT1 Protein Vector (Human) (pPB-N-His)

PV052510 500 ng
EUR 481.00

GALNT1 Protein Vector (Human) (pPM-C-HA)

PV052511 500 ng
EUR 481.00

GALNT1 Protein Vector (Human) (pPM-C-His)

PV052512 500 ng
EUR 481.00

Recombinant Mouse GALNT1 Protein, His, Insect-1ug

QP11928-1ug 1ug
EUR 155.00

Recombinant Mouse GALNT1 Protein, His, Insect-50ug

QP11928-50ug 50ug
EUR 1261.00

Recombinant Mouse GALNT1 Protein, His, Insect-5ug

QP11928-5ug 5ug
EUR 201.00

GALNT1 Protein Vector (Rat) (pPB-C-His)

PV269542 500 ng
EUR 603.00

GALNT1 Protein Vector (Rat) (pPB-N-His)

PV269543 500 ng
EUR 603.00

GALNT1 Protein Vector (Rat) (pPM-C-HA)

PV269544 500 ng
EUR 603.00

GALNT1 Protein Vector (Rat) (pPM-C-His)

PV269545 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-C-His)

PV181082 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-N-His)

PV181083 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-HA)

PV181084 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-His)

PV181085 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-C-His)

PV181086 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-N-His)

PV181087 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-HA)

PV181088 500 ng
EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-His)

PV181089 500 ng
EUR 603.00

GALNT1 Protein Vector (Human) (pPB-C-His)

PV017149 500 ng
EUR 329.00

GALNT1 Protein Vector (Human) (pPB-N-His)

PV017150 500 ng
EUR 329.00

GALNT1 Protein Vector (Human) (pPM-C-HA)

PV017151 500 ng
EUR 329.00

GALNT1 Protein Vector (Human) (pPM-C-His)

PV017152 500 ng
EUR 329.00

Galnt1 3'UTR Luciferase Stable Cell Line

TU204922 1.0 ml Ask for price

Galnt1 3'UTR GFP Stable Cell Line

TU156880 1.0 ml Ask for price

GALNT1 3'UTR Luciferase Stable Cell Line

TU008520 1.0 ml
EUR 1521.00

Galnt1 3'UTR Luciferase Stable Cell Line

TU106880 1.0 ml Ask for price

GALNT1 3'UTR GFP Stable Cell Line

TU058520 1.0 ml
EUR 1521.00

Galnt1 3'UTR GFP Stable Cell Line

TU254922 1.0 ml Ask for price

Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit

E02P0806-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit

E02P0806-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit

E02P0806-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.