GALNT1 siRNA
20-abx902082	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT1 siRNA
20-abx917534	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT1 siRNA
20-abx917535	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GALNT1
YF-PA11924	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GALNT1

anti-GALNT1
YF-PA23757	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GALNT1

GALNT1 cloning plasmid
CSB-CL607410HU1-10ug	Cusabio	10ug	EUR 199
Formulation: 10 μg plasmid + 200μl Glycerol Length: 318 Sequence: atgagaaaatttgcatactgcaaggtggtcctagccacctccttgatttgggtactcttggatatgttcctgctgctttacttcagtgaatgcaacaaatgtgatgaaaaaaaggagagaggacttcctgctggagatgttctagagccagtacaaaagcctcatgaaggtcctgg Show more
Description: A cloning plasmid for the GALNT1 gene.

GALNT1 cloning plasmid
CSB-CL607410HU2-10ug	Cusabio	10ug	EUR 530
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1500 Sequence: ATGGGGAAACCAGTCGTCATTCCTAAAGAGGATCAAGAAAAGATGAAAGAGATGTTTAAAATCAATCAGTTCAATTTAATGGCAAGTGAGATGATTGCACTCAACAGATCTTTACCAGATGTTAGGTTAGAAGGGTGTAAAACAAAGGTGTATCCAGATAATCTTCCTACAACAA Show more
Description: A cloning plasmid for the GALNT1 gene.

Anti-GALNT1 (3C10)
YF-MA13180	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GALNT1

Rat GALNT1 shRNA Plasmid
20-abx986517	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GALNT1 shRNA Plasmid
20-abx970457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT1 shRNA Plasmid
20-abx951724	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GALNT1 Recombinant Protein (Human)
RP012862	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Human)
RP039382	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Rat)
RP202154	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Mouse)
RP135809	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Mouse)
RP135812	ABM	100 ug	Ask for price

Galnt1 ORF Vector (Rat) (pORF)
ORF067386	ABM	1.0 ug DNA	EUR 506

GALNT1 ORF Vector (Human) (pORF)
ORF004288	ABM	1.0 ug DNA	EUR 95

GALNT1 ORF Vector (Human) (pORF)
ORF013128	ABM	1.0 ug DNA	EUR 354

Galnt1 ORF Vector (Mouse) (pORF)
ORF045271	ABM	1.0 ug DNA	EUR 506

Galnt1 ORF Vector (Mouse) (pORF)
ORF045272	ABM	1.0 ug DNA	EUR 506

Bovine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1
ELI-27199b	Lifescience Market	96 Tests	EUR 928

Porcine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1
ELI-07931p	Lifescience Market	96 Tests	EUR 928

Galnt1 sgRNA CRISPR Lentivector set (Rat)
K7020501	ABM	3 x 1.0 ug	EUR 339

Galnt1 sgRNA CRISPR Lentivector set (Mouse)
K3758501	ABM	3 x 1.0 ug	EUR 339

GALNT1 sgRNA CRISPR Lentivector set (Human)
K0835101	ABM	3 x 1.0 ug	EUR 339

Rat Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 ELI
ELI-21419r	Lifescience Market	96 Tests	EUR 886

Human Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1 E
ELI-30795h	Lifescience Market	96 Tests	EUR 824

Mouse Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 E
ELI-30946m	Lifescience Market	96 Tests	EUR 865

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7020502	ABM	1.0 ug DNA	EUR 154

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7020503	ABM	1.0 ug DNA	EUR 154

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7020504	ABM	1.0 ug DNA	EUR 154

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3758502	ABM	1.0 ug DNA	EUR 154

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3758503	ABM	1.0 ug DNA	EUR 154

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3758504	ABM	1.0 ug DNA	EUR 154

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0835102	ABM	1.0 ug DNA	EUR 154

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0835103	ABM	1.0 ug DNA	EUR 154

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0835104	ABM	1.0 ug DNA	EUR 154

GALNT1 Protein Vector (Rat) (pPB-C-His)
PV269542	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Rat) (pPB-N-His)
PV269543	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Rat) (pPM-C-HA)
PV269544	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Rat) (pPM-C-His)
PV269545	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPB-C-His)
PV181082	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPB-N-His)
PV181083	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPM-C-HA)
PV181084	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPM-C-His)
PV181085	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPB-C-His)
PV181086	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPB-N-His)
PV181087	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPM-C-HA)
PV181088	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Mouse) (pPM-C-His)
PV181089	ABM	500 ng	EUR 603

GALNT1 Protein Vector (Human) (pPB-C-His)
PV017149	ABM	500 ng	EUR 329

GALNT1 Protein Vector (Human) (pPB-N-His)
PV017150	ABM	500 ng	EUR 329

GALNT1 Protein Vector (Human) (pPM-C-HA)
PV017151	ABM	500 ng	EUR 329

GALNT1 Protein Vector (Human) (pPM-C-His)
PV017152	ABM	500 ng	EUR 329

GALNT1 Protein Vector (Human) (pPB-C-His)
PV052509	ABM	500 ng	EUR 481

GALNT1 Protein Vector (Human) (pPB-N-His)
PV052510	ABM	500 ng	EUR 481

GALNT1 Protein Vector (Human) (pPM-C-HA)
PV052511	ABM	500 ng	EUR 481

GALNT1 Protein Vector (Human) (pPM-C-His)
PV052512	ABM	500 ng	EUR 481

Recombinant Mouse GALNT1 Protein, His, Insect-1ug
QP11928-1ug	EnQuireBio	1ug	EUR 155

Recombinant Mouse GALNT1 Protein, His, Insect-50ug
QP11928-50ug	EnQuireBio	50ug	EUR 1261

Recombinant Mouse GALNT1 Protein, His, Insect-5ug
QP11928-5ug	EnQuireBio	5ug	EUR 201

Galnt1 3'UTR Luciferase Stable Cell Line
TU106880	ABM	1.0 ml	Ask for price

Galnt1 3'UTR GFP Stable Cell Line
TU156880	ABM	1.0 ml	Ask for price

Galnt1 3'UTR Luciferase Stable Cell Line
TU204922	ABM	1.0 ml	Ask for price

Galnt1 3'UTR GFP Stable Cell Line
TU254922	ABM	1.0 ml	Ask for price

GALNT1 3'UTR GFP Stable Cell Line
TU058520	ABM	1.0 ml	EUR 1521

GALNT1 3'UTR Luciferase Stable Cell Line
TU008520	ABM	1.0 ml	EUR 1521

Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E04P0806-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E04P0806-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E04P0806-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.