GALNT1

GALNT1 siRNA
20-abx917534	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT1 siRNA
20-abx917535	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GALNT1 Antibody
abx145974-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

anti-GALNT1
YF-PA11924	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to GALNT1

anti-GALNT1
YF-PA23757	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to GALNT1

GALNT1 cloning plasmid
CSB-CL607410HU1-10ug	Cusabio	10ug	EUR 199.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 318 Sequence: atgagaaaatttgcatactgcaaggtggtcctagccacctccttgatttgggtactcttggatatgttcctgctgctttacttcagtgaatgcaacaaatgtgatgaaaaaaaggagagaggacttcctgctggagatgttctagagccagtacaaaagcctcatgaaggtcctgg Show more
Description: A cloning plasmid for the GALNT1 gene.

GALNT1 cloning plasmid
CSB-CL607410HU2-10ug	Cusabio	10ug	EUR 530.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1500 Sequence: ATGGGGAAACCAGTCGTCATTCCTAAAGAGGATCAAGAAAAGATGAAAGAGATGTTTAAAATCAATCAGTTCAATTTAATGGCAAGTGAGATGATTGCACTCAACAGATCTTTACCAGATGTTAGGTTAGAAGGGTGTAAAACAAAGGTGTATCCAGATAATCTTCCTACAACAA Show more
Description: A cloning plasmid for the GALNT1 gene.

Anti-GALNT1 (3C10)
YF-MA13180	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to GALNT1

Rat GALNT1 shRNA Plasmid
20-abx986517	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GALNT1 shRNA Plasmid
20-abx970457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GALNT1 shRNA Plasmid
20-abx951724	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GALNT1 Recombinant Protein (Rat)
RP202154	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Human)
RP012862	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Human)
RP039382	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Mouse)
RP135809	ABM	100 ug	Ask for price

GALNT1 Recombinant Protein (Mouse)
RP135812	ABM	100 ug	Ask for price

GALNT1 ORF Vector (Human) (pORF)
ORF013128	ABM	1.0 ug DNA	EUR 354.00

GALNT1 ORF Vector (Human) (pORF)
ORF004288	ABM	1.0 ug DNA	EUR 95.00

Galnt1 ORF Vector (Mouse) (pORF)
ORF045271	ABM	1.0 ug DNA	EUR 506.00

Galnt1 ORF Vector (Mouse) (pORF)
ORF045272	ABM	1.0 ug DNA	EUR 506.00

Galnt1 ORF Vector (Rat) (pORF)
ORF067386	ABM	1.0 ug DNA	EUR 506.00

GALNT1 sgRNA CRISPR Lentivector set (Human)
K0835101	ABM	3 x 1.0 ug	EUR 339.00

Bovine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1
ELI-27199b	Lifescience Market	96 Tests	EUR 928.00

Galnt1 sgRNA CRISPR Lentivector set (Mouse)
K3758501	ABM	3 x 1.0 ug	EUR 339.00

Porcine Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1
ELI-07931p	Lifescience Market	96 Tests	EUR 928.00

Galnt1 sgRNA CRISPR Lentivector set (Rat)
K7020501	ABM	3 x 1.0 ug	EUR 339.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0835102	ABM	1.0 ug DNA	EUR 154.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0835103	ABM	1.0 ug DNA	EUR 154.00

GALNT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0835104	ABM	1.0 ug DNA	EUR 154.00

Rat Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 ELI
ELI-21419r	Lifescience Market	96 Tests	EUR 886.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3758502	ABM	1.0 ug DNA	EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3758503	ABM	1.0 ug DNA	EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3758504	ABM	1.0 ug DNA	EUR 154.00

Human Polypeptide N- acetylgalactosaminyltransferase 1, GALNT1 E
ELI-30795h	Lifescience Market	96 Tests	EUR 824.00

Mouse Polypeptide N- acetylgalactosaminyltransferase 1, Galnt1 E
ELI-30946m	Lifescience Market	96 Tests	EUR 865.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7020502	ABM	1.0 ug DNA	EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7020503	ABM	1.0 ug DNA	EUR 154.00

Galnt1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7020504	ABM	1.0 ug DNA	EUR 154.00

GALNT1 Protein Vector (Mouse) (pPB-C-His)
PV181082	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-N-His)
PV181083	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-HA)
PV181084	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-His)
PV181085	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-C-His)
PV181086	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPB-N-His)
PV181087	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-HA)
PV181088	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Mouse) (pPM-C-His)
PV181089	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Human) (pPB-C-His)
PV052509	ABM	500 ng	EUR 481.00

GALNT1 Protein Vector (Human) (pPB-N-His)
PV052510	ABM	500 ng	EUR 481.00

GALNT1 Protein Vector (Human) (pPM-C-HA)
PV052511	ABM	500 ng	EUR 481.00

GALNT1 Protein Vector (Human) (pPM-C-His)
PV052512	ABM	500 ng	EUR 481.00

GALNT1 Protein Vector (Human) (pPB-C-His)
PV017149	ABM	500 ng	EUR 329.00

GALNT1 Protein Vector (Human) (pPB-N-His)
PV017150	ABM	500 ng	EUR 329.00

GALNT1 Protein Vector (Human) (pPM-C-HA)
PV017151	ABM	500 ng	EUR 329.00

GALNT1 Protein Vector (Human) (pPM-C-His)
PV017152	ABM	500 ng	EUR 329.00

GALNT1 3'UTR Luciferase Stable Cell Line
TU008520	ABM	1.0 ml	EUR 1521.00

Galnt1 3'UTR GFP Stable Cell Line
TU156880	ABM	1.0 ml	Ask for price

Galnt1 3'UTR Luciferase Stable Cell Line
TU204922	ABM	1.0 ml	Ask for price

GALNT1 Protein Vector (Rat) (pPB-C-His)
PV269542	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Rat) (pPB-N-His)
PV269543	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Rat) (pPM-C-HA)
PV269544	ABM	500 ng	EUR 603.00

GALNT1 Protein Vector (Rat) (pPM-C-His)
PV269545	ABM	500 ng	EUR 603.00

GALNT1 3'UTR GFP Stable Cell Line
TU058520	ABM	1.0 ml	EUR 1521.00

Galnt1 3'UTR Luciferase Stable Cell Line
TU106880	ABM	1.0 ml	Ask for price

Galnt1 3'UTR GFP Stable Cell Line
TU254922	ABM	1.0 ml	Ask for price

Recombinant Mouse GALNT1 Protein, His, Insect-1ug
QP11928-1ug	EnQuireBio	1ug	EUR 155.00

Recombinant Mouse GALNT1 Protein, His, Insect-50ug
QP11928-50ug	EnQuireBio	50ug	EUR 1261.00

Recombinant Mouse GALNT1 Protein, His, Insect-5ug
QP11928-5ug	EnQuireBio	5ug	EUR 201.00

Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E03P0806-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E03P0806-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) ELISA kit
E03P0806-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Polypeptide N acetylgalactosaminyltransferase 1(GALNT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.