GALNT4

GALNT4 Antibody

DF13031 200ul
EUR 304.00
Description: GALNT4 Antibody detects endogenous levels of GALNT4.

GALNT4 antibody

70R-7245 50 ug
EUR 467.00
Description: Rabbit polyclonal GALNT4 antibody

GALNT4 antibody

70R-7248 50 ug
EUR 467.00
Description: Rabbit polyclonal GALNT4 antibody

GALNT4 Antibody

1-CSB-PA009211GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT4. Recognizes GALNT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GALNT4 siRNA

20-abx917540
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GALNT4 siRNA

20-abx917541
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-GALNT4

YF-PA15797 50 ul
EUR 363.00
Description: Mouse polyclonal to GALNT4

anti-GALNT4

YF-PA15798 100 ug
EUR 403.00
Description: Rabbit polyclonal to GALNT4

GALNT4 Blocking Peptide

33R-1400 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7245

GALNT4 Blocking Peptide

33R-9559 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7248

GALNT4 Blocking Peptide

DF13031-BP 1mg
EUR 195.00

GALNT4 cloning plasmid

CSB-CL836662HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atggcggtgaggtggacttgggcaggcaagagctgcctgctgctggcgtttttaacagtggcctatatcttcgtggagctcttggtctctacttttcatgcctccgcaggagccggccgtgccagggagctggggtcaagaaggctctcaggcctccagaaaaatacggaggatt
  • Show more
Description: A cloning plasmid for the GALNT4 gene.

GALNT4 Rabbit pAb

A4243-100ul 100 ul
EUR 308.00

GALNT4 Rabbit pAb

A4243-200ul 200 ul
EUR 459.00

GALNT4 Rabbit pAb

A4243-20ul 20 ul Ask for price

GALNT4 Rabbit pAb

A4243-50ul 50 ul Ask for price

anti- GALNT4 antibody

FNab03324 100µg
EUR 548.75
  • Immunogen: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4(GalNAc-T4)
  • Uniprot ID: Q8N4A0
  • Gene ID: 8693
  • Research Area: Metabolism
Description: Antibody raised against GALNT4

Anti-GALNT4 antibody

PAab03324 100 ug
EUR 386.00

Anti-GALNT4 antibody

STJ26586 100 µl
EUR 277.00
Description: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist.

Human GALNT4 ELISA KIT

ELI-30796h 96 Tests
EUR 824.00

Mouse Galnt4 ELISA KIT

ELI-27156m 96 Tests
EUR 865.00

GALNT4 ELISA KIT|Human

EF009763 96 Tests
EUR 689.00

Human GALNT4 shRNA Plasmid

20-abx955721
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GALNT4 shRNA Plasmid

20-abx970459
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GALNT4 Recombinant Protein (Human)

RP012883 100 ug Ask for price

GALNT4 Recombinant Protein (Rat)

RP202175 100 ug Ask for price

GALNT4 Recombinant Protein (Mouse)

RP135836 100 ug Ask for price

Galnt4 ORF Vector (Rat) (pORF)

ORF067393 1.0 ug DNA
EUR 506.00

GALNT4 ORF Vector (Human) (pORF)

ORF004295 1.0 ug DNA
EUR 95.00

Galnt4 ORF Vector (Mouse) (pORF)

ORF045280 1.0 ug DNA
EUR 506.00

POC1B-GALNT4 Recombinant Protein (Human)

RP084084 100 ug Ask for price

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx025629-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx025629-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

20-abx003143
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

20-abx116519
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx036817-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx122500-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody

abx233324-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Galnt4 sgRNA CRISPR Lentivector set (Rat)

K7515601 3 x 1.0 ug
EUR 339.00

Galnt4 sgRNA CRISPR Lentivector set (Mouse)

K3418201 3 x 1.0 ug
EUR 339.00

GALNT4 sgRNA CRISPR Lentivector set (Human)

K0835401 3 x 1.0 ug
EUR 339.00

POC1B-GALNT4 ORF Vector (Human) (pORF)

ORF028029 1.0 ug DNA Ask for price

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7515602 1.0 ug DNA
EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7515603 1.0 ug DNA
EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7515604 1.0 ug DNA
EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3418202 1.0 ug DNA
EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3418203 1.0 ug DNA
EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3418204 1.0 ug DNA
EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0835402 1.0 ug DNA
EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0835403 1.0 ug DNA
EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0835404 1.0 ug DNA
EUR 154.00

GALNT4 Protein Vector (Rat) (pPB-C-His)

PV269570 500 ng
EUR 603.00

GALNT4 Protein Vector (Rat) (pPB-N-His)

PV269571 500 ng
EUR 603.00

GALNT4 Protein Vector (Rat) (pPM-C-HA)

PV269572 500 ng
EUR 603.00

GALNT4 Protein Vector (Rat) (pPM-C-His)

PV269573 500 ng
EUR 603.00

GALNT4 Protein Vector (Mouse) (pPB-C-His)

PV181118 500 ng
EUR 603.00

GALNT4 Protein Vector (Mouse) (pPB-N-His)

PV181119 500 ng
EUR 603.00

GALNT4 Protein Vector (Mouse) (pPM-C-HA)

PV181120 500 ng
EUR 603.00

GALNT4 Protein Vector (Mouse) (pPM-C-His)

PV181121 500 ng
EUR 603.00

GALNT4 Protein Vector (Human) (pPB-C-His)

PV017177 500 ng
EUR 329.00

GALNT4 Protein Vector (Human) (pPB-N-His)

PV017178 500 ng
EUR 329.00

GALNT4 Protein Vector (Human) (pPM-C-HA)

PV017179 500 ng
EUR 329.00

GALNT4 Protein Vector (Human) (pPM-C-His)

PV017180 500 ng
EUR 329.00

Galnt4 3'UTR Luciferase Stable Cell Line

TU106887 1.0 ml Ask for price

Galnt4 3'UTR GFP Stable Cell Line

TU156887 1.0 ml Ask for price

Galnt4 3'UTR Luciferase Stable Cell Line

TU204930 1.0 ml Ask for price

Galnt4 3'UTR GFP Stable Cell Line

TU254930 1.0 ml Ask for price

GALNT4 3'UTR GFP Stable Cell Line

TU058523 1.0 ml
EUR 2333.00

GALNT4 3'UTR Luciferase Stable Cell Line

TU008523 1.0 ml
EUR 2333.00

Human Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) ELISA Kit

abx387484-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.