GALNT4 siRNA
20-abx917541	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GALNT4 antibody
70R-7245	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GALNT4 antibody

GALNT4 antibody
70R-7248	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GALNT4 antibody

GALNT4 antibody
70R-17414	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GALNT4 antibody

GALNT4 Antibody
DF13031	Affbiotech	200ul	EUR 304.00
Description: GALNT4 Antibody detects endogenous levels of GALNT4.

GALNT4 Antibody
1-CSB-PA009211GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GALNT4. Recognizes GALNT4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-GALNT4
YF-PA15797	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to GALNT4

anti-GALNT4
YF-PA15798	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to GALNT4

anti- GALNT4 antibody
FNab03324	FN Test	100µg	EUR 548.75
Immunogen: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4(GalNAc-T4) Uniprot ID: Q8N4A0 Gene ID: 8693 Research Area: Metabolism
Description: Antibody raised against GALNT4

GALNT4 Rabbit pAb
A4243-100ul	Abclonal	100 ul	EUR 308.00

GALNT4 Rabbit pAb
A4243-200ul	Abclonal	200 ul	EUR 459.00

GALNT4 Rabbit pAb
A4243-20ul	Abclonal	20 ul	Ask for price

GALNT4 Rabbit pAb
A4243-50ul	Abclonal	50 ul	Ask for price

GALNT4 Blocking Peptide
33R-1400	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7245

GALNT4 Blocking Peptide
33R-9559	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT4 antibody, catalog no. 70R-7248

GALNT4 Blocking Peptide
DF13031-BP	Affbiotech	1mg	EUR 195.00

GALNT4 cloning plasmid
CSB-CL836662HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1737 Sequence: atggcggtgaggtggacttgggcaggcaagagctgcctgctgctggcgtttttaacagtggcctatatcttcgtggagctcttggtctctacttttcatgcctccgcaggagccggccgtgccagggagctggggtcaagaaggctctcaggcctccagaaaaatacggaggatt Show more
Description: A cloning plasmid for the GALNT4 gene.

Anti-GALNT4 antibody
PAab03324	Lifescience Market	100 ug	EUR 386.00

Anti-GALNT4 antibody
STJ26586	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist.

Mouse Galnt4 ELISA KIT
ELI-27156m	Lifescience Market	96 Tests	EUR 865.00

GALNT4 ELISA KIT|Human
EF009763	Lifescience Market	96 Tests	EUR 689.00

Human GALNT4 ELISA KIT
ELI-30796h	Lifescience Market	96 Tests	EUR 824.00

Human GALNT4 shRNA Plasmid
20-abx955721	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse GALNT4 shRNA Plasmid
20-abx970459	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GALNT4 Recombinant Protein (Human)
RP012883	ABM	100 ug	Ask for price

GALNT4 Recombinant Protein (Rat)
RP202175	ABM	100 ug	Ask for price

GALNT4 Recombinant Protein (Mouse)
RP135836	ABM	100 ug	Ask for price

GALNT4 ORF Vector (Human) (pORF)
ORF004295	ABM	1.0 ug DNA	EUR 95.00

Galnt4 ORF Vector (Rat) (pORF)
ORF067393	ABM	1.0 ug DNA	EUR 506.00

Galnt4 ORF Vector (Mouse) (pORF)
ORF045280	ABM	1.0 ug DNA	EUR 506.00

POC1B-GALNT4 Recombinant Protein (Human)
RP084084	ABM	100 ug	Ask for price

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
20-abx116519	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
abx122500-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
20-abx003143	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
abx036817-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
abx025629-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
abx025629-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) Antibody
abx233324-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Galnt4 sgRNA CRISPR Lentivector set (Mouse)
K3418201	ABM	3 x 1.0 ug	EUR 339.00

GALNT4 sgRNA CRISPR Lentivector set (Human)
K0835401	ABM	3 x 1.0 ug	EUR 339.00

Galnt4 sgRNA CRISPR Lentivector set (Rat)
K7515601	ABM	3 x 1.0 ug	EUR 339.00

POC1B-GALNT4 ORF Vector (Human) (pORF)
ORF028029	ABM	1.0 ug DNA	Ask for price

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3418202	ABM	1.0 ug DNA	EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3418203	ABM	1.0 ug DNA	EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3418204	ABM	1.0 ug DNA	EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0835402	ABM	1.0 ug DNA	EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0835403	ABM	1.0 ug DNA	EUR 154.00

GALNT4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0835404	ABM	1.0 ug DNA	EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7515602	ABM	1.0 ug DNA	EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7515603	ABM	1.0 ug DNA	EUR 154.00

Galnt4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7515604	ABM	1.0 ug DNA	EUR 154.00

GALNT4 Protein Vector (Rat) (pPB-C-His)
PV269570	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Rat) (pPB-N-His)
PV269571	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Rat) (pPM-C-HA)
PV269572	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Rat) (pPM-C-His)
PV269573	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Mouse) (pPB-C-His)
PV181118	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Mouse) (pPB-N-His)
PV181119	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Mouse) (pPM-C-HA)
PV181120	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Mouse) (pPM-C-His)
PV181121	ABM	500 ng	EUR 603.00

GALNT4 Protein Vector (Human) (pPB-C-His)
PV017177	ABM	500 ng	EUR 329.00

GALNT4 Protein Vector (Human) (pPB-N-His)
PV017178	ABM	500 ng	EUR 329.00

GALNT4 Protein Vector (Human) (pPM-C-HA)
PV017179	ABM	500 ng	EUR 329.00

GALNT4 Protein Vector (Human) (pPM-C-His)
PV017180	ABM	500 ng	EUR 329.00

Galnt4 3'UTR Luciferase Stable Cell Line
TU204930	ABM	1.0 ml	Ask for price

Galnt4 3'UTR GFP Stable Cell Line
TU156887	ABM	1.0 ml	Ask for price

GALNT4 3'UTR Luciferase Stable Cell Line
TU008523	ABM	1.0 ml	EUR 2333.00

Galnt4 3'UTR Luciferase Stable Cell Line
TU106887	ABM	1.0 ml	Ask for price

GALNT4 3'UTR GFP Stable Cell Line
TU058523	ABM	1.0 ml	EUR 2333.00

Galnt4 3'UTR GFP Stable Cell Line
TU254930	ABM	1.0 ml	Ask for price

Human Polypeptide N-Acetylgalactosaminyltransferase 4 (GALNT4) ELISA Kit
abx387484-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.