gcdh antibody

GCDH Antibody

47125-100ul 100ul
EUR 252.00

GCDH antibody

70R-2402 50 ug
EUR 467.00
Description: Rabbit polyclonal GCDH antibody raised against the N terminal of GCDH

GCDH antibody

70R-1103 100 ug
EUR 377.00
Description: Rabbit polyclonal GCDH antibody raised against the C terminal of GCDH

GCDH Antibody

DF12614 200ul
EUR 304.00
Description: GCDH Antibody detects endogenous levels of GCDH.

GCDH Conjugated Antibody

C47125 100ul
EUR 397.00

GCDH Polyclonal Antibody

A66898 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-GCDH antibody

STJ111546 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA11976 50 ul
EUR 363.00
Description: Mouse polyclonal to GCDH


YF-PA11977 50 ug
EUR 363.00
Description: Mouse polyclonal to GCDH


YF-PA11978 100 ug
EUR 403.00
Description: Rabbit polyclonal to GCDH

GCDH Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GCDH Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GCDH Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCDH. Recognizes GCDH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCDH cloning plasmid

CSB-CL849798HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1317
  • Sequence: atggccctgagaggcgtctccgtgcggctgctgagccgcggacccggcctgcacgtccttcgcacgtgggtctcgtcggcggcgcagaccgagaaaggcgggagaacacagagccaactggctaagtcctcgcgtcccgagtttgactggcaggacccgctggtgctggaggagc
  • Show more
Description: A cloning plasmid for the GCDH gene.

GCDH Blocking Peptide

33R-3897 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GCDH antibody, catalog no. 70R-1103

GCDH Blocking Peptide

33R-8632 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GCDH antibody, catalog no. 70R-2402

GCDH Blocking Peptide

DF12614-BP 1mg
EUR 195.00

GCDH Rabbit pAb

A9057-100ul 100 ul
EUR 308.00

GCDH Rabbit pAb

A9057-200ul 200 ul
EUR 459.00

GCDH Rabbit pAb

A9057-20ul 20 ul
EUR 183.00

GCDH Rabbit pAb

A9057-50ul 50 ul
EUR 223.00

GCDH Polyclonal Antibody, HRP Conjugated

A66899 100 µg
EUR 570.55
Description: The best epigenetics products

GCDH Polyclonal Antibody, FITC Conjugated

A66900 100 µg
EUR 570.55
Description: kits suitable for this type of research

GCDH Polyclonal Antibody, Biotin Conjugated

A66901 100 µg
EUR 570.55
Description: fast delivery possible

Glutaryl Coenzyme A Dehydrogenase (GCDH) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutaryl-CoA Dehydrogenase, Mitochondrial (GCDH) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glutaryl-CoA Dehydrogenase, Mitochondrial (GCDH) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse GCDH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GCDH protein (His tag)

80R-1384 50 ug
EUR 397.00
Description: Purified recombinant Human GCDH protein

Human GCDH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF005050 96 Tests
EUR 689.00

GCDH Recombinant Protein (Rat)

RP202349 100 ug Ask for price

GCDH Recombinant Protein (Human)

RP013015 100 ug Ask for price

GCDH Recombinant Protein (Mouse)

RP136109 100 ug Ask for price

GCDH Recombinant Protein (Mouse)

RP136112 100 ug Ask for price

Glutaryl-CoA Dehydrogenase, Mitochondrial (GCDH) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutaryl-CoA Dehydrogenase, Mitochondrial (GCDH) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutaryl-CoA Dehydrogenase, Mitochondrial (GCDH) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GCDH ORF Vector (Human) (pORF)

ORF004339 1.0 ug DNA
EUR 95.00

Gcdh ORF Vector (Mouse) (pORF)

ORF045371 1.0 ug DNA
EUR 506.00

Gcdh ORF Vector (Mouse) (pORF)

ORF045372 1.0 ug DNA
EUR 506.00

Gcdh ORF Vector (Rat) (pORF)

ORF067451 1.0 ug DNA
EUR 506.00

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH)

GCDH sgRNA CRISPR Lentivector set (Human)

K0846201 3 x 1.0 ug
EUR 339.00

Gcdh sgRNA CRISPR Lentivector set (Mouse)

K3877201 3 x 1.0 ug
EUR 339.00

Recombinant Glutaryl Coenzyme A Dehydrogenase (GCDH)

  • EUR 390.30
  • EUR 208.00
  • EUR 1188.64
  • EUR 462.88
  • EUR 825.76
  • EUR 324.00
  • EUR 2821.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92947
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glutaryl Coenzyme A Dehydrogenase expressed in: E.coli

Recombinant Glutaryl Coenzyme A Dehydrogenase (GCDH)

  • EUR 417.18
  • EUR 215.00
  • EUR 1289.44
  • EUR 496.48
  • EUR 892.96
  • EUR 342.00
  • EUR 3073.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q60759
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Glutaryl Coenzyme A Dehydrogenase expressed in: E.coli

Gcdh sgRNA CRISPR Lentivector set (Rat)

K7532101 3 x 1.0 ug
EUR 339.00

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH)

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with APC.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with Biotin.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with Cy3.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with FITC.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with HRP.

Glutaryl Coenzyme A Dehydrogenase (GCDH) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GCDH (Glu270~Lys438)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH). This antibody is labeled with PE.

GCDH sgRNA CRISPR Lentivector (Human) (Target 1)

K0846202 1.0 ug DNA
EUR 154.00

GCDH sgRNA CRISPR Lentivector (Human) (Target 2)

K0846203 1.0 ug DNA
EUR 154.00

GCDH sgRNA CRISPR Lentivector (Human) (Target 3)

K0846204 1.0 ug DNA
EUR 154.00

Gcdh sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3877202 1.0 ug DNA
EUR 154.00

Gcdh sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3877203 1.0 ug DNA
EUR 154.00

Gcdh sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3877204 1.0 ug DNA
EUR 154.00

Human Glutaryl Coenzyme A Dehydrogenase (GCDH) Protein

  • EUR 551.00
  • EUR 258.00
  • EUR 1609.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Glutaryl Coenzyme A Dehydrogenase (GCDH) Protein

  • EUR 592.00
  • EUR 258.00
  • EUR 1748.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gcdh sgRNA CRISPR Lentivector (Rat) (Target 1)

K7532102 1.0 ug DNA
EUR 154.00

Gcdh sgRNA CRISPR Lentivector (Rat) (Target 2)

K7532103 1.0 ug DNA
EUR 154.00

Gcdh sgRNA CRISPR Lentivector (Rat) (Target 3)

K7532104 1.0 ug DNA
EUR 154.00

GCDH Protein Vector (Mouse) (pPB-C-His)

PV181482 500 ng
EUR 603.00