GNB1

Mouse G Protein Beta 1 (GNb1) ELISA Kit

DL-GNb1-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse G Protein Beta 1 (GNb1)

Mouse G Protein Beta 1 (GNb1) ELISA Kit

DL-GNb1-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse G Protein Beta 1 (GNb1)

Mouse G Protein Beta 1 (GNb1) ELISA Kit

DLR-GNb1-Mu-48T 48T
EUR 527.00
  • Should the Mouse G Protein Beta 1 (GNb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Beta 1 (GNb1) in samples from tissue homogenates or other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

DLR-GNb1-Mu-96T 96T
EUR 688.00
  • Should the Mouse G Protein Beta 1 (GNb1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Beta 1 (GNb1) in samples from tissue homogenates or other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RD-GNb1-Mu-48Tests 48 Tests
EUR 533.00

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RD-GNb1-Mu-96Tests 96 Tests
EUR 740.00

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RDR-GNb1-Mu-48Tests 48 Tests
EUR 557.00

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RDR-GNb1-Mu-96Tests 96 Tests
EUR 774.00

Gnb1/ Rat Gnb1 ELISA Kit

ELI-09679r 96 Tests
EUR 886.00

GNB1 Antibody

1-CSB-PA009602GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNB1 Antibody

1-CSB-PA009602LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GNB1 Antibody

1-CSB-PA725644
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNB1 Antibody

35745-100ul 100ul
EUR 252.00

GNB1 antibody

70R-3117 50 ug
EUR 467.00
Description: Rabbit polyclonal GNB1 antibody

GNB1 antibody

70R-3118 50 ug
EUR 467.00
Description: Rabbit polyclonal GNB1 antibody

GNB1 Antibody

ABD9564 100 ug
EUR 438.00

GNB1 antibody

70R-17525 50 ul
EUR 435.00
Description: Rabbit polyclonal GNB1 antibody

GNB1 siRNA

20-abx902219
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 siRNA

20-abx918172
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 siRNA

20-abx918173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 Antibody

1-CSB-PA897922
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNB1 Antibody

DF9564 200ul
EUR 304.00
Description: GNB1 Antibody detects endogenous levels of total GNB1.

GNB1 Conjugated Antibody

C35745 100ul
EUR 397.00

GNB1 cloning plasmid

CSB-CL009602HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: atgagtgagcttgaccagttacggcaggaggccgagcaacttaagaaccagattcgagacgccaggaaagcatgtgcagatgcaactctctctcagatcacaaacaacatcgacccagtgggaagaatccaaatgcgcacgaggaggacactgcgggggcacctggccaagatct
  • Show more
Description: A cloning plasmid for the GNB1 gene.

GNB1 Blocking Peptide

33R-2064 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB1 antibody, catalog no. 70R-3118

GNB1 Blocking Peptide

33R-6416 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB1 antibody, catalog no. 70R-3117

DANRE gnb1 Antibody

abx034969-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

DANRE gnb1 Antibody

abx034969-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

GNB1 Polyclonal Antibody

E-AB-10332-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptor
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat GNB1 for WB,IHC,ELISA applications.

GNB1 Polyclonal Antibody

E-AB-10332-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptor
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat GNB1 for WB,IHC,ELISA applications.

GNB1 Polyclonal Antibody

E-AB-10332-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptor
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat GNB1 for WB,IHC,ELISA applications.

Anti-GNB1 Antibody

PB10067 100ug/vial
EUR 334.00

Anti-GNB1 antibody

PAab03538 100 ug
EUR 355.00

GNB1 Blocking Peptide

DF9564-BP 1mg
EUR 195.00

anti- GNB1 antibody

FNab03538 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), beta polypeptide 1
  • Uniprot ID: P62873
  • Gene ID: 2782
  • Research Area: Signal Transduction
Description: Antibody raised against GNB1

GNB1 Rabbit pAb

A1867-100ul 100 ul
EUR 308.00

GNB1 Rabbit pAb

A1867-200ul 200 ul
EUR 459.00

GNB1 Rabbit pAb

A1867-20ul 20 ul
EUR 183.00

GNB1 Rabbit pAb

A1867-50ul 50 ul
EUR 223.00

Anti-GNB1 antibody

STJ111116 100 µl
EUR 277.00
Description: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants.

GNB1 Antibody, HRP conjugated

1-CSB-PA009602LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNB1 Antibody, FITC conjugated

1-CSB-PA009602LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNB1 Antibody, Biotin conjugated

1-CSB-PA009602LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat GNB1 shRNA Plasmid

20-abx984469
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNB1 shRNA Plasmid

20-abx970587
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNB1 protein (His tag)

80R-3798 50 ug
EUR 435.00
Description: Purified recombinant GNB1 protein (His tag)

Human GNB1 ELISA KIT

ELI-27205h 96 Tests
EUR 824.00

Canine GNB1 ELISA KIT

ELI-27307d 96 Tests
EUR 928.00

Human GNB1 shRNA Plasmid

20-abx951854
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gnb1 ELISA KIT

ELI-47371m 96 Tests
EUR 865.00

Bovine GNB1 ELISA KIT

ELI-48364b 96 Tests
EUR 928.00

GNB1 Recombinant Protein (Rat)

RP202988 100 ug Ask for price

GNB1 Recombinant Protein (Human)

RP013504 100 ug Ask for price

GNB1 Recombinant Protein (Mouse)

RP138956 100 ug Ask for price

GNB1 Recombinant Protein (Mouse)

RP138959 100 ug Ask for price

GNB1 Recombinant Protein (Mouse)

RP138962 100 ug Ask for price

Anserini GNb1 ELISA Kit

EAG0217 96Tests
EUR 521.00

Bovine GNb1 ELISA Kit

EBG0217 96Tests
EUR 521.00

Human GNb1 ELISA Kit

EHG0217 96Tests
EUR 521.00

Goat GNb1 ELISA Kit

EGTG0217 96Tests
EUR 521.00