GRP

Human Gla Rich Protein (GRP) ELISA Kit

DL-GRP-Hu-48 1 kit of 48 tests
EUR 447.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Gla Rich Protein (GRP)

Human Gla Rich Protein (GRP) ELISA Kit

DL-GRP-Hu-96 1 kit of 96 tests
EUR 597.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Gla Rich Protein (GRP)

Human Gla Rich Protein (GRP) ELISA Kit

DLR-GRP-Hu-48T 48T
EUR 479.00
  • Should the Human Gla Rich Protein (GRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gla Rich Protein (GRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Gla Rich Protein (GRP) ELISA Kit

DLR-GRP-Hu-96T 96T
EUR 621.00
  • Should the Human Gla Rich Protein (GRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gla Rich Protein (GRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Gla Rich Protein (GRP) ELISA Kit

RD-GRP-Hu-48Tests 48 Tests
EUR 478.00

Human Gla Rich Protein (GRP) ELISA Kit

RD-GRP-Hu-96Tests 96 Tests
EUR 662.00

Human Gla Rich Protein (GRP) ELISA Kit

RDR-GRP-Hu-48Tests 48 Tests
EUR 500.00

Human Gla Rich Protein (GRP) ELISA Kit

RDR-GRP-Hu-96Tests 96 Tests
EUR 692.00

Grp/ Rat Grp ELISA Kit

ELI-04062r 96 Tests
EUR 886.00

GRP Antibody

1-CSB-PA009940EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GRP Antibody

1-CSB-PA009940GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GRP Antibody

1-CSB-PA009940HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GRP Antibody

1-CSB-PA017220
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRP. Recognizes GRP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

GRP antibody

38863-100ul 100ul
EUR 252.00

GRP Antibody

35749-100ul 100ul
EUR 252.00

GRP siRNA

20-abx918750
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRP siRNA

20-abx918751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRP (porcine)

B5170-.5 500 µg
EUR 224.00

GRP (porcine)

B5170-1 1 mg
EUR 328.00

GRP (human)

B5171-.5 500 ?g
EUR 248.00

GRP (human)

B5171-1 1 mg
EUR 321.00

GRP (human)

B5171-5 5 mg
EUR 991.00

GRP (porcine)

H-1635.0500 0.5mg
EUR 273.00
Description: Sum Formula: C126H198N38O31S2; CAS# [74815-57-9]

GRP (porcine)

H-1635.1000 1.0mg
EUR 454.00
Description: Sum Formula: C126H198N38O31S2; CAS# [74815-57-9]

GRP (human)

H-6785.0500 0.5mg
EUR 200.00
Description: Sum Formula: C130H204N38O31S2; CAS# [93755-85-2]

GRP (human)

H-6785.1000 1.0mg
EUR 334.00
Description: Sum Formula: C130H204N38O31S2; CAS# [93755-85-2]

GRP Conjugated Antibody

C35749 100ul
EUR 397.00

GRP Conjugated Antibody

C38863 100ul
EUR 397.00

GRP Polyclonal Antibody

A57181 100 µg
EUR 570.55
Description: fast delivery possible

GRP Polyclonal Antibody

A54404 100 µg
EUR 570.55
Description: Ask the seller for details

Pro-GRP Protein

abx060216-100ug 100 ug
EUR 996.00
  • Shipped within 5-10 working days.

GRP cloning plasmid

CSB-CL009940HU-10ug 10ug
EUR 234.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atgcgcggccgtgagctcccgctggtcctgctggcgctggtcctctgcctggcgccccgggggcgagcggtcccgctgcctgcgggcggagggaccgtgctgaccaagatgtacccgcgcggcaaccactgggcggtggggcacttaatggggaaaaagagcacaggggagtcttc
  • Show more
Description: A cloning plasmid for the GRP gene.

GRP Polyclonal Antibody

E-AB-10338-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. Its preproprotein,
  • Show more
Description: Rabbit antibody against Human,Mouse GRP for WB,ELISA applications.

GRP Polyclonal Antibody

E-AB-10338-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. Its preproprotein,
  • Show more
Description: Rabbit antibody against Human,Mouse GRP for WB,ELISA applications.

GRP Polyclonal Antibody

E-AB-10338-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. Its preproprotein,
  • Show more
Description: Rabbit antibody against Human,Mouse GRP for WB,ELISA applications.

Pro-GRP antigen

E62C03001 20ug
EUR 382.00

Human GRP Antibody

32095-05111 150 ug
EUR 261.00

GRP (Porcine) antibody

Y160 50 ul
EUR 427.00
Description: The GRP (Porcine) antibody is available in Europe and for worldwide shipping via Gentaur.

GRP Rabbit pAb

A6380-100ul 100 ul
EUR 308.00

GRP Rabbit pAb

A6380-200ul 200 ul
EUR 459.00

GRP Rabbit pAb

A6380-20ul 20 ul
EUR 183.00

GRP Rabbit pAb

A6380-50ul 50 ul
EUR 223.00

Anti-GRP antibody

STJ28463 100 µl
EUR 277.00
Description: This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. The encoded preproprotein is proteolytically processed to generate two peptides, gastrin-releasing peptide and neuromedin-C. These peptides regulate numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation. These peptides are also likely to play a role in human cancers of the lung, colon, stomach, pancreas, breast, and prostate. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed.

GRP Antibody, HRP conjugated

1-CSB-PA009940EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GRP Antibody, FITC conjugated

1-CSB-PA009940EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GRP Antibody, Biotin conjugated

1-CSB-PA009940ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GRP Antibody, HRP conjugated

1-CSB-PA009940HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GRP Antibody, FITC conjugated

1-CSB-PA009940HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GRP Antibody, Biotin conjugated

1-CSB-PA009940HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GRP. Recognizes GRP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse GRP shRNA Plasmid

20-abx981416
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRP (1-16) (porcine)

5-01261 4 x 1mg Ask for price

Human GRP shRNA Plasmid

20-abx951975
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRP (14-27) Peptide

20-abx265265
  • EUR 551.00
  • EUR 926.00
  • EUR 398.00
  • 10 mg
  • 25 mg
  • 5 mg
  • Shipped within 5-10 working days.

GRP ELISA KIT|Human

EF002837 96 Tests
EUR 689.00

Human GRP ELISA Kit

ELA-E1226h 96 Tests
EUR 824.00

GRP (1-16) (porcine)

H-5930.0001 1.0mg
EUR 273.00
Description: Sum Formula: C70H115N17O20S; CAS# [95211-11-3]

GRP (1-16) (porcine)

H-5930.0005 5.0mg
EUR 998.00
Description: Sum Formula: C70H115N17O20S; CAS# [95211-11-3]

Canine GRP ELISA KIT

ELI-04064d 96 Tests
EUR 928.00

GRP Recombinant Protein (Rat)

RP203750 100 ug Ask for price

GRP Recombinant Protein (Human)

RP014059 100 ug Ask for price