  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

JOSD1 Antibody

39621-100ul 100ul
EUR 390

JOSD1 antibody

31881-100ul 100ul
EUR 252

JOSD1 antibody

31881-50ul 50ul
EUR 187

JOSD1 Rabbit pAb

A10426-100ul 100 ul
EUR 308

JOSD1 Rabbit pAb

A10426-200ul 200 ul
EUR 459

JOSD1 Rabbit pAb

A10426-20ul 20 ul
EUR 183

JOSD1 Rabbit pAb

A10426-50ul 50 ul
EUR 223

JOSD1 Polyclonal Antibody

27432-100ul 100ul
EUR 252

JOSD1 Polyclonal Antibody

27432-50ul 50ul
EUR 187

JOSD1 cloning plasmid

CSB-CL624012HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 609
  • Sequence: atgagttgtgtgccatggaaaggagacaaggccaaatctgaatcattggagctgccccaggcagcacccccacaaatctaccatgagaaacagcgcagggagctttgtgccctccacgccctcaataacgtcttccaggacagcaatgccttcacccgggatacgctgcaagagat
  • Show more
Description: A cloning plasmid for the JOSD1 gene.

Anti-JOSD1 antibody

STJ112458 100 µl
EUR 277

JOSD1 Polyclonal Conjugated Antibody

C31881 100ul
EUR 397

JOSD1 Polyclonal Conjugated Antibody

C27432 100ul
EUR 397

Mouse JOSD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat JOSD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Josephin-1 (JOSD1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Josephin-1 (JOSD1) Antibody

abx036467-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human JOSD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

JOSD1 protein (His tag)

80R-2508 20 ug
EUR 322
Description: Purified recombinant JOSD1 protein (His tag)

Human Josephin-1 (JOSD1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 39.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Josephin-1(JOSD1) expressed in E.coli

JOSD1 Recombinant Protein (Human)

RP016495 100 ug Ask for price

JOSD1 Recombinant Protein (Rat)

RP206543 100 ug Ask for price

JOSD1 Recombinant Protein (Mouse)

RP144734 100 ug Ask for price

Human Josephin-1 (JOSD1) Antibody

32685-05111 150 ug
EUR 261

JOSD1 ORF Vector (Human) (pORF)

ORF005499 1.0 ug DNA
EUR 95

Josd1 ORF Vector (Rat) (pORF)

ORF068849 1.0 ug DNA
EUR 506

Josd1 ORF Vector (Mouse) (pORF)

ORF048246 1.0 ug DNA
EUR 506

Human Josephin- 1, JOSD1 ELISA KIT

ELI-21249h 96 Tests
EUR 824

Mouse Josephin- 1, Josd1 ELISA KIT

ELI-39426m 96 Tests
EUR 865

Bovine Josephin- 1, JOSD1 ELISA KIT

ELI-42303b 96 Tests
EUR 928

JOSD1 sgRNA CRISPR Lentivector set (Human)

K1111801 3 x 1.0 ug
EUR 339

Josd1 sgRNA CRISPR Lentivector set (Mouse)

K4013901 3 x 1.0 ug
EUR 339

Josd1 sgRNA CRISPR Lentivector set (Rat)

K7377001 3 x 1.0 ug
EUR 339

Human Josephin-1 (JOSD1) Antibody (Biotin Conjugate)

32685-05121 150 ug
EUR 369

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1111802 1.0 ug DNA
EUR 154

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1111803 1.0 ug DNA
EUR 154

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1111804 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4013902 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4013903 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4013904 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7377002 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7377003 1.0 ug DNA
EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7377004 1.0 ug DNA
EUR 154

JOSD1 Protein Vector (Human) (pPB-C-His)

PV021993 500 ng
EUR 329

JOSD1 Protein Vector (Human) (pPB-N-His)

PV021994 500 ng
EUR 329

JOSD1 Protein Vector (Human) (pPM-C-HA)

PV021995 500 ng
EUR 329

JOSD1 Protein Vector (Human) (pPM-C-His)

PV021996 500 ng
EUR 329

JOSD1 Protein Vector (Rat) (pPB-C-His)

PV275394 500 ng
EUR 603

JOSD1 Protein Vector (Rat) (pPB-N-His)

PV275395 500 ng
EUR 603

JOSD1 Protein Vector (Rat) (pPM-C-HA)

PV275396 500 ng
EUR 603

JOSD1 Protein Vector (Rat) (pPM-C-His)

PV275397 500 ng
EUR 603

JOSD1 Protein Vector (Mouse) (pPB-C-His)

PV192982 500 ng
EUR 603

JOSD1 Protein Vector (Mouse) (pPB-N-His)

PV192983 500 ng
EUR 603

JOSD1 Protein Vector (Mouse) (pPM-C-HA)

PV192984 500 ng
EUR 603

JOSD1 Protein Vector (Mouse) (pPM-C-His)

PV192985 500 ng
EUR 603

Josd1 3'UTR Luciferase Stable Cell Line

TU206485 1.0 ml Ask for price

Josd1 3'UTR GFP Stable Cell Line

TU160346 1.0 ml Ask for price

JOSD1 3'UTR Luciferase Stable Cell Line

TU011409 1.0 ml
EUR 1521

Josd1 3'UTR Luciferase Stable Cell Line

TU110346 1.0 ml Ask for price

JOSD1 3'UTR GFP Stable Cell Line

TU061409 1.0 ml
EUR 1521

Josd1 3'UTR GFP Stable Cell Line

TU256485 1.0 ml Ask for price

Human Josephin-1 (JOSD1) AssayLite Antibody (FITC Conjugate)

32685-05141 150 ug
EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (RPE Cconjugate)

32685-05151 150 ug
EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (APC Conjugate)

32685-05161 150 ug
EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (PerCP Conjugate)

32685-05171 150 ug
EUR 471

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV682255 1.0 ug DNA
EUR 514

JOSD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV682259 1.0 ug DNA
EUR 514

JOSD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV682260 1.0 ug DNA
EUR 514

JOSD1 Josephin Domain Containing 1 Human Recombinant Protein

PROTQ15040 Regular: 20ug
EUR 317
Description: JOSD1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-202 a.a.) and having a molecular mass of 25.6kDa.;JOSD1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1111805 3 x 1.0 ug
EUR 376

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4013905 3 x 1.0 ug
EUR 376

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7377005 3 x 1.0 ug
EUR 376

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1111806 1.0 ug DNA
EUR 167

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1111807 1.0 ug DNA
EUR 167

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1111808 1.0 ug DNA
EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4013906 1.0 ug DNA
EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4013907 1.0 ug DNA
EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4013908 1.0 ug DNA
EUR 167

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV682256 1.0 ug DNA
EUR 514

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV682257 1.0 ug DNA
EUR 572

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV682258 1.0 ug DNA
EUR 572

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7377006 1.0 ug DNA
EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7377007 1.0 ug DNA
EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7377008 1.0 ug DNA
EUR 167