JOSD1 siRNA
20-abx902750	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JOSD1 siRNA
20-abx921053	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JOSD1 siRNA
20-abx921054	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

JOSD1 Antibody
39621-100ul	SAB	100ul	EUR 390

JOSD1 antibody
31881-100ul	SAB	100ul	EUR 252

JOSD1 antibody
31881-50ul	SAB	50ul	EUR 187

JOSD1 Rabbit pAb
A10426-100ul	Abclonal	100 ul	EUR 308

JOSD1 Rabbit pAb
A10426-200ul	Abclonal	200 ul	EUR 459

JOSD1 Rabbit pAb
A10426-20ul	Abclonal	20 ul	EUR 183

JOSD1 Rabbit pAb
A10426-50ul	Abclonal	50 ul	EUR 223

JOSD1 Polyclonal Antibody
27432-100ul	SAB	100ul	EUR 252

JOSD1 Polyclonal Antibody
27432-50ul	SAB	50ul	EUR 187

JOSD1 cloning plasmid
CSB-CL624012HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 609 Sequence: atgagttgtgtgccatggaaaggagacaaggccaaatctgaatcattggagctgccccaggcagcacccccacaaatctaccatgagaaacagcgcagggagctttgtgccctccacgccctcaataacgtcttccaggacagcaatgccttcacccgggatacgctgcaagagat Show more
Description: A cloning plasmid for the JOSD1 gene.

Anti-JOSD1 antibody
STJ112458	St John's Laboratory	100 µl	EUR 277

JOSD1 Polyclonal Conjugated Antibody
C31881	SAB	100ul	EUR 397

JOSD1 Polyclonal Conjugated Antibody
C27432	SAB	100ul	EUR 397

Mouse JOSD1 shRNA Plasmid
20-abx978121	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat JOSD1 shRNA Plasmid
20-abx989862	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Josephin-1 (JOSD1) Antibody
20-abx126024	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Josephin-1 (JOSD1) Antibody
abx036467-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Human JOSD1 shRNA Plasmid
20-abx956674	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

JOSD1 protein (His tag)
80R-2508	Fitzgerald	20 ug	EUR 322
Description: Purified recombinant JOSD1 protein (His tag)

Human Josephin-1 (JOSD1)
1-CSB-EP624012HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Josephin-1(JOSD1) expressed in E.coli

JOSD1 Recombinant Protein (Human)
RP016495	ABM	100 ug	Ask for price

JOSD1 Recombinant Protein (Rat)
RP206543	ABM	100 ug	Ask for price

JOSD1 Recombinant Protein (Mouse)
RP144734	ABM	100 ug	Ask for price

Human Josephin-1 (JOSD1) Antibody
32685-05111	AssayPro	150 ug	EUR 261

JOSD1 ORF Vector (Human) (pORF)
ORF005499	ABM	1.0 ug DNA	EUR 95

Josd1 ORF Vector (Rat) (pORF)
ORF068849	ABM	1.0 ug DNA	EUR 506

Josd1 ORF Vector (Mouse) (pORF)
ORF048246	ABM	1.0 ug DNA	EUR 506

Human Josephin- 1, JOSD1 ELISA KIT
ELI-21249h	Lifescience Market	96 Tests	EUR 824

Mouse Josephin- 1, Josd1 ELISA KIT
ELI-39426m	Lifescience Market	96 Tests	EUR 865

Bovine Josephin- 1, JOSD1 ELISA KIT
ELI-42303b	Lifescience Market	96 Tests	EUR 928

JOSD1 sgRNA CRISPR Lentivector set (Human)
K1111801	ABM	3 x 1.0 ug	EUR 339

Josd1 sgRNA CRISPR Lentivector set (Mouse)
K4013901	ABM	3 x 1.0 ug	EUR 339

Josd1 sgRNA CRISPR Lentivector set (Rat)
K7377001	ABM	3 x 1.0 ug	EUR 339

Human Josephin-1 (JOSD1) Antibody (Biotin Conjugate)
32685-05121	AssayPro	150 ug	EUR 369

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1111802	ABM	1.0 ug DNA	EUR 154

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1111803	ABM	1.0 ug DNA	EUR 154

JOSD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1111804	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4013902	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4013903	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4013904	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7377002	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7377003	ABM	1.0 ug DNA	EUR 154

Josd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7377004	ABM	1.0 ug DNA	EUR 154

JOSD1 Protein Vector (Human) (pPB-C-His)
PV021993	ABM	500 ng	EUR 329

JOSD1 Protein Vector (Human) (pPB-N-His)
PV021994	ABM	500 ng	EUR 329

JOSD1 Protein Vector (Human) (pPM-C-HA)
PV021995	ABM	500 ng	EUR 329

JOSD1 Protein Vector (Human) (pPM-C-His)
PV021996	ABM	500 ng	EUR 329

JOSD1 Protein Vector (Rat) (pPB-C-His)
PV275394	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Rat) (pPB-N-His)
PV275395	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Rat) (pPM-C-HA)
PV275396	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Rat) (pPM-C-His)
PV275397	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Mouse) (pPB-C-His)
PV192982	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Mouse) (pPB-N-His)
PV192983	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Mouse) (pPM-C-HA)
PV192984	ABM	500 ng	EUR 603

JOSD1 Protein Vector (Mouse) (pPM-C-His)
PV192985	ABM	500 ng	EUR 603

Josd1 3'UTR Luciferase Stable Cell Line
TU206485	ABM	1.0 ml	Ask for price

Josd1 3'UTR GFP Stable Cell Line
TU160346	ABM	1.0 ml	Ask for price

JOSD1 3'UTR Luciferase Stable Cell Line
TU011409	ABM	1.0 ml	EUR 1521

Josd1 3'UTR Luciferase Stable Cell Line
TU110346	ABM	1.0 ml	Ask for price

JOSD1 3'UTR GFP Stable Cell Line
TU061409	ABM	1.0 ml	EUR 1521

Josd1 3'UTR GFP Stable Cell Line
TU256485	ABM	1.0 ml	Ask for price

Human Josephin-1 (JOSD1) AssayLite Antibody (FITC Conjugate)
32685-05141	AssayPro	150 ug	EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (RPE Cconjugate)
32685-05151	AssayPro	150 ug	EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (APC Conjugate)
32685-05161	AssayPro	150 ug	EUR 428

Human Josephin-1 (JOSD1) AssayLite Antibody (PerCP Conjugate)
32685-05171	AssayPro	150 ug	EUR 471

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV682255	ABM	1.0 ug DNA	EUR 514

JOSD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV682259	ABM	1.0 ug DNA	EUR 514

JOSD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV682260	ABM	1.0 ug DNA	EUR 514

JOSD1 Josephin Domain Containing 1 Human Recombinant Protein
PROTQ15040	BosterBio	Regular: 20ug	EUR 317
Description: JOSD1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 225 amino acids (1-202 a.a.) and having a molecular mass of 25.6kDa.;JOSD1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1111805	ABM	3 x 1.0 ug	EUR 376

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4013905	ABM	3 x 1.0 ug	EUR 376

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7377005	ABM	3 x 1.0 ug	EUR 376

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1111806	ABM	1.0 ug DNA	EUR 167

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1111807	ABM	1.0 ug DNA	EUR 167

JOSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1111808	ABM	1.0 ug DNA	EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4013906	ABM	1.0 ug DNA	EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4013907	ABM	1.0 ug DNA	EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4013908	ABM	1.0 ug DNA	EUR 167

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV682256	ABM	1.0 ug DNA	EUR 514

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV682257	ABM	1.0 ug DNA	EUR 572

JOSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV682258	ABM	1.0 ug DNA	EUR 572

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7377006	ABM	1.0 ug DNA	EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7377007	ABM	1.0 ug DNA	EUR 167

Josd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7377008	ABM	1.0 ug DNA	EUR 167