KLK1

Human Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Hu-48 1 kit of 48 tests
EUR 413.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Kallikrein 1 (KLK1)

Human Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Hu-96 1 kit of 96 tests
EUR 547.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Kallikrein 1 (KLK1)

Mouse Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Mu-192 1 kit of 192 tests
EUR 978.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Kallikrein 1 (KLK1)

Mouse Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Mu-48 1 kit of 48 tests
EUR 421.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Kallikrein 1 (KLK1)

Mouse Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Mu-96 1 kit of 96 tests
EUR 559.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Kallikrein 1 (KLK1)

Rat Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Ra-192 1 kit of 192 tests
EUR 1023.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Kallikrein 1 (KLK1)

Rat Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Ra-48 1 kit of 48 tests
EUR 437.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Kallikrein 1 (KLK1)

Rat Kallikrein 1 (KLK1) ELISA Kit

DL-KLK1-Ra-96 1 kit of 96 tests
EUR 581.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Kallikrein 1 (KLK1)

Human Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Hu-48T 48T
EUR 441.00
  • Should the Human Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Hu-96T 96T
EUR 570.00
  • Should the Human Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Mu-48T 48T
EUR 450.00
  • Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Mouse Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Mu-96T 96T
EUR 582.00
  • Should the Mouse Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 1 (KLK1) in samples from serum, plasma or other biological fluids.

Rat Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Ra-48T 48T
EUR 467.00
  • Should the Rat Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kallikrein 1 (KLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Kallikrein 1 (KLK1) ELISA Kit

DLR-KLK1-Ra-96T 96T
EUR 605.00
  • Should the Rat Kallikrein 1 (KLK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Kallikrein 1 (KLK1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Hu-48Tests 48 Tests
EUR 436.00

Human Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Hu-96Tests 96 Tests
EUR 601.00

Mouse Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Mu-48Tests 48 Tests
EUR 446.00

Mouse Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Mu-96Tests 96 Tests
EUR 615.00

Rat Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Ra-48Tests 48 Tests
EUR 465.00

Rat Kallikrein 1 (KLK1) ELISA Kit

RD-KLK1-Ra-96Tests 96 Tests
EUR 643.00

Human Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Hu-48Tests 48 Tests
EUR 455.00

Human Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Hu-96Tests 96 Tests
EUR 629.00

Mouse Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Mu-48Tests 48 Tests
EUR 465.00

Mouse Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Mu-96Tests 96 Tests
EUR 643.00

Rat Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Ra-48Tests 48 Tests
EUR 486.00

Rat Kallikrein 1 (KLK1) ELISA Kit

RDR-KLK1-Ra-96Tests 96 Tests
EUR 672.00

KLK1 siRNA

20-abx921836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK1 siRNA

20-abx921837
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK1 Antibody

ABD6628 100 ug
EUR 438.00

KLK1 Antibody

1-CSB-PA012446GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KLK1 Antibody

1-CSB-PA012446LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:300, IF:1:50-1:200

KLK1 Antibody

32443-100ul 100ul
EUR 252.00

KLK1 antibody

70R-14162 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal KLK1 antibody

KLK1 antibody

70R-14170 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal KLK1 antibody

KLK1 antibody

70R-18160 50 ul
EUR 435.00
Description: Rabbit polyclonal KLK1 antibody

KLK1 Antibody

1-CSB-PA005798
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

KLK1 Antibody

1-CSB-PA248038
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

KLK1 Antibody

1-CSB-PA086611
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

KLK1 Antibody

DF6628 200ul
EUR 304.00
Description: KLK1 Antibody detects endogenous levels of total KLK1.

KLK1 Polyclonal Antibody

A55243 100 µg
EUR 570.55
Description: The best epigenetics products

KLK1 Polyclonal Antibody

ABP53180-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK1
  • Applications tips:
Description: A polyclonal antibody for detection of KLK1 from Human. This KLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK1

KLK1 Polyclonal Antibody

ABP53180-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK1
  • Applications tips:
Description: A polyclonal antibody for detection of KLK1 from Human. This KLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK1

KLK1 Polyclonal Antibody

ABP53180-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK1
  • Applications tips:
Description: A polyclonal antibody for detection of KLK1 from Human. This KLK1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK1

KLK1 Polyclonal Antibody

E-AB-10421-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence s
  • Show more
Description: Rabbit antibody against Human KLK1 for IHC,ELISA applications.

KLK1 Polyclonal Antibody

E-AB-10421-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence s
  • Show more
Description: Rabbit antibody against Human KLK1 for IHC,ELISA applications.

KLK1 Polyclonal Antibody

E-AB-10421-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence s
  • Show more
Description: Rabbit antibody against Human KLK1 for IHC,ELISA applications.

KLK1 Polyclonal Antibody

E-AB-30194-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growi
  • Show more
Description: Rabbit antibody against Human KLK1 for WB,ELISA applications.

KLK1 Polyclonal Antibody

E-AB-30194-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growi
  • Show more
Description: Rabbit antibody against Human KLK1 for WB,ELISA applications.

KLK1 Polyclonal Antibody

E-AB-30194-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growi
  • Show more
Description: Rabbit antibody against Human KLK1 for WB,ELISA applications.

KLK1 Polyclonal Antibody

ES4179-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against KLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK1 Polyclonal Antibody

ES4179-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against KLK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK1 Conjugated Antibody

C32443 100ul
EUR 397.00

KLK1 cloning plasmid

CSB-CL012446HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atgtggttcctggttctgtgcctcgccctgtccctgggggggactggtgctgcgcccccgattcagtcccggattgtgggaggctgggagtgtgagcagcattcccagccctggcaggcggctctgtaccatttcagcactttccagtgtgggggcatcctggtgcaccgccagtg
  • Show more
Description: A cloning plasmid for the KLK1 gene.

KLK1 Rabbit pAb

A1807-100ul 100 ul
EUR 308.00

KLK1 Rabbit pAb

A1807-200ul 200 ul
EUR 459.00

KLK1 Rabbit pAb

A1807-20ul 20 ul
EUR 183.00

KLK1 Rabbit pAb

A1807-50ul 50 ul
EUR 223.00

KLK1 Blocking Peptide

DF6628-BP 1mg
EUR 195.00

Anti-KLK1 antibody

STJ24329 100 µl
EUR 277.00
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. This protein is functionally conserved in its capacity to release the vasoactive peptide, Lys-bradykinin, from low molecular weight kininogen.

Anti-KLK1 antibody

STJ71119 100 µg
EUR 359.00

Anti-KLK1 antibody

STJ96814 200 µl
EUR 197.00
Description: Rabbit polyclonal to KLK1.

Kallikrein 1 (KLK1) Antibody

20-abx225263
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 1 (KLK1) Antibody

abx234456-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Kallikrein 1 (KLK1) Antibody

20-abx323736
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 1 (KLK1) Antibody

20-abx339851
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 1 (KLK1) Antibody

20-abx339852
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human KLK1 ELISA Kit

55R-1788 1 kit
EUR 685.00
Description: ELISA kit for detection of KLK1 in the research laboratory

KLK1 protein (His tag)

80R-2518 50 ug
EUR 327.00
Description: Purified recombinant KLK1 protein (His tag)

Kallikrein 1 (KLK1) Antibody

20-abx001495
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

KLK1 Antibody, HRP conjugated

1-CSB-PA012446LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KLK1 Antibody, FITC conjugated

1-CSB-PA012446LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KLK1 Antibody, Biotin conjugated

1-CSB-PA012446LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLK1. Recognizes KLK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KLK1 ELISA KIT|Human

EF002647 96 Tests
EUR 689.00

Mouse KLK1 shRNA Plasmid

20-abx971205
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KLK1 shRNA Plasmid

20-abx952585
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Kallikrein 1 (KLK1) Antibody

20-abx177237
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 1 (KLK1) Antibody

20-abx177238
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 1 (KLK1) Antibody

20-abx177239
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 1 (KLK1) Antibody

20-abx177240
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 1 (KLK1) Antibody

20-abx173219
  • EUR 718.00
  • EUR 384.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 1 (KLK1) Antibody

20-abx173220
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 1 (Klk1) Antibody

abx431375-200ul 200 ul
EUR 286.00
  • Shipped within 1-3 working days.

Kallikrein 1 (KLK1) Antibody

abx432897-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Kallikrein 1 (KLK1) Antibody

20-abx109952
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kallikrein 1 (KLK1) Antibody

20-abx129821
  • EUR 356.00
  • EUR 133.00
  • EUR 1024.00
  • EUR 509.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 1 (KLK1) Antibody

20-abx113304
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 1 (KLK1) Antibody

20-abx100973
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 1 (KLK1) Antibody

20-abx100974
  • EUR 398.00
  • EUR 133.00
  • EUR 1066.00
  • EUR 523.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Kallikrein-1 (KLK1)

1-CSB-EP012446HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Kallikrein-1(KLK1) expressed in E.coli

Human KLK1 ELISA kit

LF-EK50753 1×96T
EUR 648.00

KLK1 Recombinant Protein (Human)

RP017221 100 ug Ask for price

KLK1 Recombinant Protein (Rat)

RP207383 100 ug Ask for price

Recombinant Kallikrein 1 (KLK1)

4-RPA967Hu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06870
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 1 expressed in: E.coli

Recombinant Kallikrein 1 (KLK1)

4-RPA967Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15947
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.0kDa
  • Isoelectric Point: 5.7
Description: Recombinant Mouse Kallikrein 1 expressed in: E.coli

Recombinant Kallikrein 1 (KLK1)

4-RPA967Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P00758
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.8kDa
  • Isoelectric Point: 4.9
Description: Recombinant Rat Kallikrein 1 expressed in: E.coli