Lars2

LARS2 siRNA

20-abx922283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARS2 antibody

10R-1762 100 ug
EUR 512.00
Description: Mouse monoclonal LARS2 antibody

LARS2 antibody

22247-100ul 100ul
EUR 390.00

LARS2 antibody

22745-100ul 100ul
EUR 390.00

LARS2 Antibody

1-CSB-PA012758GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LARS2. Recognizes LARS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LARS2 Antibody

1-CSB-PA613580ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LARS2. Recognizes LARS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LARS2 antibody

70R-13281 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal LARS2 antibody

LARS2 antibody

70R-13339 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal LARS2 antibody

LARS2 antibody

70R-18217 50 ul
EUR 435.00
Description: Rabbit polyclonal LARS2 antibody

pBlueScriptR-LARS2

PVT17325 2 ug
EUR 258.00

anti-LARS2

YF-PA17865 100 ug
EUR 403.00
Description: Rabbit polyclonal to LARS2

anti-LARS2

YF-PA25876 50 ul
EUR 334.00
Description: Mouse polyclonal to LARS2

LARS2 Antibody

DF13122 200ul
EUR 304.00
Description: LARS2 Antibody detects endogenous levels of LARS2.

LARS2 cloning plasmid

CSB-CL613580HU-10ug 10ug
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2712
  • Sequence: atggcttctgtttggcagagattgggtttttatgcctctcttctgaaaagacagctaaatggtgggccagatgtcatcaagtgggaaaggagagtaattcccggatgtaccagaagcatctacagtgccacgggaaagtggacaaaagagtatacattgcagacaagaaaggatg
  • Show more
Description: A cloning plasmid for the LARS2 gene.

Anti-LARS2 (3F12)

YF-MA17871 100 ug
EUR 363.00
Description: Mouse monoclonal to LARS2

LARS2 Blocking Peptide

DF13122-BP 1mg
EUR 195.00

Anti-LARS2 antibody

PAab04702 100 ug
EUR 355.00

anti- LARS2 antibody

FNab04702 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: leucyl-tRNA synthetase 2, mitochondrial
  • Uniprot ID: Q15031
  • Gene ID: 23395
  • Research Area: Metabolism
Description: Antibody raised against LARS2

LARS2 ELISA KIT|Human

EF010624 96 Tests
EUR 689.00

Mouse Lars2 ELISA KIT

ELI-53116m 96 Tests
EUR 865.00

Human LARS2 ELISA KIT

ELI-53398h 96 Tests
EUR 824.00

Human LARS2 shRNA Plasmid

20-abx958236
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LARS2 shRNA Plasmid

20-abx979542
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LARS2 ORF Vector (Human) (pORF)

ORF005846 1.0 ug DNA
EUR 95.00

Lars2 ORF Vector (Mouse) (pORF)

ORF048965 1.0 ug DNA
EUR 506.00

Lars2 ORF Vector (Rat) (pORF)

ORF069281 1.0 ug DNA
EUR 506.00

Lars2 sgRNA CRISPR Lentivector set (Rat)

K6519001 3 x 1.0 ug
EUR 339.00

LARS2 sgRNA CRISPR Lentivector set (Human)

K1197101 3 x 1.0 ug
EUR 339.00

Lars2 sgRNA CRISPR Lentivector set (Mouse)

K5000401 3 x 1.0 ug
EUR 339.00

LARS2-AS1 ORF Vector (Human) (pORF)

ORF022621 1.0 ug DNA Ask for price

Probable Leucine-tRNA Ligase, Mitochondrial (LARS2) Antibody

abx234702-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Probable Leucine-tRNA Ligase, Mitochondrial (LARS2) Antibody

20-abx321045
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Probable Leucine-tRNA Ligase, Mitochondrial (LARS2) Antibody

abx122977-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Probable Leucine-tRNA Ligase, Mitochondrial (LARS2) Antibody

20-abx113486
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lars2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6519002 1.0 ug DNA
EUR 154.00

Lars2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6519003 1.0 ug DNA
EUR 154.00

Lars2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6519004 1.0 ug DNA
EUR 154.00

LARS2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1197102 1.0 ug DNA
EUR 154.00

LARS2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1197103 1.0 ug DNA
EUR 154.00

LARS2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1197104 1.0 ug DNA
EUR 154.00

LARS2 Protein Vector (Rat) (pPB-C-His)

PV277122 500 ng
EUR 1166.00

LARS2 Protein Vector (Rat) (pPB-N-His)

PV277123 500 ng
EUR 1166.00

LARS2 Protein Vector (Rat) (pPM-C-HA)

PV277124 500 ng
EUR 1166.00

LARS2 Protein Vector (Rat) (pPM-C-His)

PV277125 500 ng
EUR 1166.00

LARS2 3'UTR GFP Stable Cell Line

TU062276 1.0 ml
EUR 1521.00

LARS2 3'UTR Luciferase Stable Cell Line

TU012276 1.0 ml
EUR 1521.00

Lars2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5000402 1.0 ug DNA
EUR 154.00

Lars2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5000403 1.0 ug DNA
EUR 154.00

Lars2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5000404 1.0 ug DNA
EUR 154.00

LARS2 Protein Vector (Mouse) (pPB-C-His)

PV195858 500 ng
EUR 1065.00

LARS2 Protein Vector (Mouse) (pPB-N-His)

PV195859 500 ng
EUR 1065.00

LARS2 Protein Vector (Mouse) (pPM-C-HA)

PV195860 500 ng
EUR 1065.00

LARS2 Protein Vector (Mouse) (pPM-C-His)

PV195861 500 ng
EUR 1065.00

Lars2 3'UTR Luciferase Stable Cell Line

TU110908 1.0 ml Ask for price

Lars2 3'UTR GFP Stable Cell Line

TU160908 1.0 ml Ask for price

Lars2 3'UTR GFP Stable Cell Line

TU256952 1.0 ml Ask for price

Lars2 3'UTR Luciferase Stable Cell Line

TU206952 1.0 ml Ask for price

LARS2 Protein Vector (Human) (pPB-C-His)

PV023381 500 ng
EUR 329.00

LARS2 Protein Vector (Human) (pPB-N-His)

PV023382 500 ng
EUR 329.00

LARS2 Protein Vector (Human) (pPM-C-HA)

PV023383 500 ng
EUR 329.00

LARS2 Protein Vector (Human) (pPM-C-His)

PV023384 500 ng
EUR 329.00

Human Probable Leucine-tRNA Ligase, Mitochondrial (LARS2) ELISA Kit

abx388229-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

LARS2-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV730841 1.0 ug DNA Ask for price

LARS2-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV730845 1.0 ug DNA Ask for price

LARS2-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV730846 1.0 ug DNA Ask for price

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6519005 3 x 1.0 ug
EUR 376.00

LARS2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1197105 3 x 1.0 ug
EUR 376.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K5000405 3 x 1.0 ug
EUR 376.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6519006 1.0 ug DNA
EUR 167.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6519007 1.0 ug DNA
EUR 167.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6519008 1.0 ug DNA
EUR 167.00

LARS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1197106 1.0 ug DNA
EUR 167.00

LARS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1197107 1.0 ug DNA
EUR 167.00

LARS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1197108 1.0 ug DNA
EUR 167.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K5000406 1.0 ug DNA
EUR 167.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K5000407 1.0 ug DNA
EUR 167.00

Lars2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K5000408 1.0 ug DNA
EUR 167.00

LARS2-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV730842 1.0 ug DNA Ask for price

LARS2-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV730843 1.0 ug DNA Ask for price

LARS2-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV730844 1.0 ug DNA Ask for price