Lcat

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Lecithin Cholesterol Acyltransferase (LCAT)

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Lecithin Cholesterol Acyltransferase (LCAT)

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Mu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lecithin Cholesterol Acyltransferase (LCAT)

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Mu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lecithin Cholesterol Acyltransferase (LCAT)

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Mu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Lecithin Cholesterol Acyltransferase (LCAT)

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Ra-192 1 kit of 192 tests
EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Lecithin Cholesterol Acyltransferase (LCAT)

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Ra-48 1 kit of 48 tests
EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Lecithin Cholesterol Acyltransferase (LCAT)

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DL-LCAT-Ra-96 1 kit of 96 tests
EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Lecithin Cholesterol Acyltransferase (LCAT)

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Hu-48T 48T
EUR 517.00
  • Should the Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma or other biological fluids.

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Hu-96T 96T
EUR 673.00
  • Should the Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma or other biological fluids.

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Mu-48T 48T
EUR 527.00
  • Should the Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Mu-96T 96T
EUR 688.00
  • Should the Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Ra-48T 48T
EUR 549.00
  • Should the Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma or other biological fluids.

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

DLR-LCAT-Ra-96T 96T
EUR 718.00
  • Should the Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Lecithin Cholesterol Acyltransferase (LCAT) in samples from serum, plasma or other biological fluids.

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Hu-48Tests 48 Tests
EUR 521.00

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Hu-96Tests 96 Tests
EUR 723.00

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Mu-48Tests 48 Tests
EUR 533.00

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Mu-96Tests 96 Tests
EUR 740.00

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Ra-48Tests 48 Tests
EUR 557.00

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RD-LCAT-Ra-96Tests 96 Tests
EUR 775.00

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Hu-48Tests 48 Tests
EUR 544.00

Human Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Hu-96Tests 96 Tests
EUR 756.00

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Mu-48Tests 48 Tests
EUR 557.00

Mouse Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Mu-96Tests 96 Tests
EUR 774.00

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Ra-48Tests 48 Tests
EUR 583.00

Rat Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

RDR-LCAT-Ra-96Tests 96 Tests
EUR 811.00

LCAT/ Rat LCAT ELISA Kit

ELA-E2114r 96 Tests
EUR 886.00

Lcat/ Rat Lcat ELISA Kit

ELI-06784r 96 Tests
EUR 886.00

LCAT Antibody

1-CSB-PA012783GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LCAT. Recognizes LCAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LCAT Antibody

43511-100ul 100ul
EUR 252.00

LCAT antibody

70R-7207 50 ug
EUR 467.00
Description: Rabbit polyclonal LCAT antibody raised against the C terminal of LCAT

LCAT Antibody

ABD8167 100 ug
EUR 438.00

LCAT antibody

70R-18227 50 ul
EUR 435.00
Description: Rabbit polyclonal LCAT antibody

LCAT antibody

70R-1860 100 ug
EUR 377.00
Description: Rabbit polyclonal LCAT antibody raised against the N terminal of LCAT

LCAT siRNA

20-abx922318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LCAT siRNA

20-abx922319
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LCAT Antibody

1-CSB-PA11369A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCAT. Recognizes LCAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

anti-LCAT

YF-PA12926 100 ug
EUR 403.00
Description: Rabbit polyclonal to LCAT

anti-LCAT

YF-PA24072 50 ul
EUR 334.00
Description: Mouse polyclonal to LCAT

LCAT Antibody

DF8167 200ul
EUR 304.00
Description: LCAT Antibody detects endogenous levels of total LCAT.

LCAT Conjugated Antibody

C43511 100ul
EUR 397.00

LCAT Polyclonal Antibody

A52082 100 µg
EUR 570.55
Description: reagents widely cited

LCAT cloning plasmid

CSB-CL012783HU-10ug 10ug
EUR 481.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atggggccgcccggctccccatggcagtgggtgacgctgctgctggggctgctgctccctcctgccgcccccttctggctcctcaatgtgctcttccccccgcacaccacgcccaaggctgagctcagtaaccacacacggcccgtcatcctcgtgcccggctgcctggggaatc
  • Show more
Description: A cloning plasmid for the LCAT gene.

LCAT Blocking Peptide

33R-3643 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LCAT antibody, catalog no. 70R-7207

LCAT Blocking Peptide

33R-6057 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LCAT antibody, catalog no. 70R-1860

Anti-LCAT Antibody

PA1967 100ug/vial
EUR 294.00

Anti-LCAT antibody

PAab04722 100 ug
EUR 386.00

Anti-LCAT Antibody

PB9657 100ug/vial
EUR 294.00

anti- LCAT antibody

FNab04722 100µg
EUR 548.75
  • Immunogen: lecithin-cholesterol acyltransferase
  • Uniprot ID: P04180
  • Gene ID: 3931
  • Research Area: Metabolism
Description: Antibody raised against LCAT

Anti-LCAT (4A9)

YF-MA20352 100 ug
EUR 363.00
Description: Mouse monoclonal to LCAT

LCAT Rabbit pAb

A11741-100ul 100 ul
EUR 308.00

LCAT Rabbit pAb

A11741-200ul 200 ul
EUR 459.00

LCAT Rabbit pAb

A11741-20ul 20 ul
EUR 183.00

LCAT Rabbit pAb

A11741-50ul 50 ul
EUR 223.00

LCAT Rabbit pAb

A11745-100ul 100 ul
EUR 308.00

LCAT Rabbit pAb

A11745-200ul 200 ul
EUR 459.00

LCAT Rabbit pAb

A11745-20ul 20 ul
EUR 183.00

LCAT Rabbit pAb

A11745-50ul 50 ul
EUR 223.00

LCAT Rabbit pAb

A3942-100ul 100 ul
EUR 308.00

LCAT Rabbit pAb

A3942-200ul 200 ul
EUR 459.00

LCAT Rabbit pAb

A3942-20ul 20 ul
EUR 183.00

LCAT Rabbit pAb

A3942-50ul 50 ul
EUR 223.00

LCAT Blocking Peptide

DF8167-BP 1mg
EUR 195.00

Anti-LCAT antibody

STJ73566 100 µg
EUR 359.00

Anti-LCAT antibody

STJ24378 100 µl
EUR 277.00
Description: This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency.

Anti-LCAT antibody

STJ113335 100 µl
EUR 277.00
Description: This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency.

Anti-LCAT antibody

STJ113338 100 µl
EUR 277.00
Description: This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency.

Mouse LCAT shRNA Plasmid

20-abx971288
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LCAT protein (His tag)

30R-2963 100 ug
EUR 322.00
Description: Purified recombinant Human LCAT protein (His tag)

Human LCAT shRNA Plasmid

20-abx952663
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LCAT Antibody, HRP conjugated

1-CSB-PA11369B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCAT. Recognizes LCAT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LCAT Antibody, FITC conjugated

1-CSB-PA11369C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCAT. Recognizes LCAT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LCAT Antibody, Biotin conjugated

1-CSB-PA11369D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LCAT. Recognizes LCAT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LCAT ELISA KIT|Human

EF006189 96 Tests
EUR 689.00

Human LCAT ELISA Kit

ELA-E2114h 96 Tests
EUR 824.00

Chicken LCAT ELISA KIT

ELI-06785c 96 Tests
EUR 928.00

Human LCAT ELISA KIT

ELI-06786h 96 Tests
EUR 824.00

Mouse Lcat ELISA KIT

ELI-06787m 96 Tests
EUR 865.00

LCAT Recombinant Protein (Rat)

RP207881 100 ug Ask for price

LCAT Recombinant Protein (Human)

RP017599 100 ug Ask for price

LCAT Recombinant Protein (Mouse)

RP146969 100 ug Ask for price

Sheep LCAT ELISA Kit

ESL0310 96Tests
EUR 521.00

Bovine LCAT ELISA Kit

EBL0310 96Tests
EUR 521.00

Human LCAT ELISA Kit

EHL0310 96Tests
EUR 521.00

Goat LCAT ELISA Kit

EGTL0310 96Tests
EUR 521.00

Chicken LCAT ELISA Kit

ECKL0310 96Tests
EUR 521.00

Canine LCAT ELISA Kit

ECL0310 96Tests
EUR 521.00

Mouse LCAT ELISA Kit

EML0310 96Tests
EUR 521.00

Porcine LCAT ELISA Kit

EPL0310 96Tests
EUR 521.00

Monkey LCAT ELISA Kit

EMKL0310 96Tests
EUR 521.00

Rat LCAT ELISA Kit

ERL0310 96Tests
EUR 521.00

Rabbit LCAT ELISA Kit

ERTL0310 96Tests
EUR 521.00

Active Lecithin Cholesterol Acyltransferase (LCAT)

4-APJ516Mu01
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • EUR 996.00
  • EUR 1892.00
  • EUR 610.00
  • EUR 6820.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P16301
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.7kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Lecithin Cholesterol Acyltransferase expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Human Phosphatidylcholine-sterol acyltransferase (LCAT)

1-CSB-RP113694h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phosphatidylcholine-sterol acyltransferase(LCAT),partial expressed in E.coli

LCAT Polyclonal Antibody, HRP Conjugated

A52083 100 µg
EUR 570.55
Description: Ask the seller for details