mbp

Human Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Hu-96T 96T
EUR 621
  • Should the Human Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates, cell lysates, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Mu-48T 48T
EUR 489
  • Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Mu-96T 96T
EUR 635
  • Should the Mouse Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Basic Protein (MBP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Rb-48T 48T
EUR 508
  • Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Rabbit Myelin Basic Protein (MBP) ELISA Kit

DLR-MBP-Rb-96T 96T
EUR 661
  • Should the Rabbit Myelin Basic Protein (MBP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit Myelin Basic Protein (MBP) in samples from serum, plasma or other biological fluids.

Human Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Hu-48Tests 48 Tests
EUR 500

Human Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Hu-96Tests 96 Tests
EUR 692

Mouse Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Mu-48Tests 48 Tests
EUR 511

Mouse Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Mu-96Tests 96 Tests
EUR 709

Rat Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Ra-96Tests 96 Tests
EUR 742

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Rb-48Tests 48 Tests
EUR 534

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RDR-MBP-Rb-96Tests 96 Tests
EUR 742

Human Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Hu-48Tests 48 Tests
EUR 478

Human Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Hu-96Tests 96 Tests
EUR 662

Mouse Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Mu-48Tests 48 Tests
EUR 489

Mouse Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Mu-96Tests 96 Tests
EUR 677

Rat Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Ra-96Tests 96 Tests
EUR 709

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Rb-48Tests 48 Tests
EUR 511

Rabbit Myelin Basic Protein (MBP) ELISA Kit

RD-MBP-Rb-96Tests 96 Tests
EUR 709

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-100-MBP 1 Kit
EUR 712

Mouse Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-105-MBP 1 Kit
EUR 712

Rat Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative

630-110-MBP 1 Kit
EUR 712

Rat Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-115-MBP 1 Kit
EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) Ig's ELISA Kit, 96 tests, Quantitative

630-120-MBP 1 Kit
EUR 712

Rabbit Anti-Myelin Basic Protein (MBP) IgG ELISA Kit, 96 tests, Quantitative

630-125-MBP 1 Kit
EUR 712

Human Anti-Myelin Basic Protein (MBP) IgGs ELISA Kit, 96 tests, Quantitative

630-130-MBP 1 Kit
EUR 712

Human Anti-Myelin Basic Protein (MBP) IgM ELISA Kit, 96 tests, Quantitative

630-135-MBP 1 Kit
EUR 712

MBP/ Rat MBP ELISA Kit

ELA-E0539r 96 Tests
EUR 886

MBP/ Rat MBP ELISA Kit

ELA-E1650r 96 Tests
EUR 886

MBP protein

30R-1158 0.5 mg
EUR 214
Description: Purified recombinant E.coli MBP protein

MBP antibody

20R-2750 50 ug
EUR 281
Description: Rabbit polyclonal MBP antibody

MBP antibody

20R-2860 100 ul
EUR 349
Description: Chicken polyclonal MBP antibody

MBP protein

30R-AM030 1 mg
EUR 300
Description: Purified native Human MBP protein

MBP antibody

70R-18432 50 ul
EUR 435
Description: Rabbit polyclonal MBP antibody

MBP antibody

70R-10644 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal MBP antibody

MBP antibody

70R-10674 1 ml
EUR 373
Description: Rabbit polyclonal MBP antibody

MBP antibody

70R-2324 50 ug
EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody

70R-2325 50 ug
EUR 467
Description: Rabbit polyclonal MBP antibody raised against the middle region of MBP

MBP antibody

70R-13733 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP Antibody

32374-100ul 100ul
EUR 252

MBP antibody

10R-2151 100 ul
EUR 403
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-3101 100 ug
EUR 407
Description: Mouse monoclonal GFP antibody

MBP antibody

10R-M162AP 200 ug
EUR 775
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-10450 100 ug
EUR 435
Description: Mouse monoclonal MBP antibody

MBP antibody

10R-1051 100 ul
EUR 316
Description: Mouse monoclonal MBP antibody

MBP antibody

10-M59A 1 mg
EUR 620
Description: Mouse monoclonal MBP antibody

MBP Antibody

DF6539 200ul
EUR 304
Description: MBP Antibody detects endogenous levels of total MBP.

MBP Antibody

CSB-PA261629-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

MBP Antibody

CSB-PA261629-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

MBP antibody

70R-MR055 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal MBP antibody

MBP Antibody

BF0621 200ul
EUR 376
Description: MBP antibody detects endogenous levels of total MBP.

MBP Antibody

1-CSB-PA013551GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MBP Antibody

1-CSB-PA013551LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MBP. Recognizes MBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

MBP siRNA

20-abx903180
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBP siRNA

20-abx923681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBP siRNA

20-abx923682
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBP Antibody

ABD6539 100 ug
EUR 438

MBP-Ab/ Rat MBP- Ab ELISA Kit

ELA-E0170r 96 Tests
EUR 886

MBP/MBL/ Rat MBP/ MBL ELISA Kit

ELA-E1480r 96 Tests
EUR 886

MBP protein (Bovine)

30R-M141a 10 mg
EUR 639
Description: Purified Bovine MBP protein

MBP Monoclonal Antibody

A1033-100
EUR 370

MBP Blocking Peptide

33R-2903 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MBP antibody, catalog no. 70R-2325

MBP Blocking Peptide

33R-2945 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MBP antibody, catalog no. 70R-2324

phospho MBP antibody

10R-P120a 100 ug
EUR 814
Description: Mouse monoclonal phospho MBP antibody

MBP MAPK Substrate

5-01517 4 x 5mg Ask for price

MBP (1 - 17)

5-01520 4 x 1mg Ask for price

MBP (90-106)

5-01524 4 x 1mg Ask for price

MBP-Tag Antibody

1-CSB-PA000345
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against MBP-Tag. Recognizes MBP-Tag from . This antibody is Unconjugated. Tested in the following application: WB;WB:1:5000

MBP Blocking Peptide

DF6539-BP 1mg
EUR 195

MBP-Tag Antibody

20-abx005589
  • EUR 356.00
  • EUR 495.00
  • EUR 272.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

MBP tag Antibody

abx019131-100ug 100 ug
EUR 321
  • Shipped within 5-10 working days.

MBP (pT232) Antibody

abx216743-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MBP-tag Antibody

20-abx134443
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MBP-tag Antibody

20-abx134444
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MBP (pY203) Antibody

abx032030-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MBP (pY203) Antibody

abx032030-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MBP-Tag Antibody

20-abx242883
  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MBP Blocking Peptide

BF0621-BP 1mg
EUR 195

MBP tag Antibody

abx235042-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MBP-Tag Antibody

abx235043-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MBP-Tag Antibody

20-abx330284
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MBP cloning plasmid

CSB-CL013551HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 594
  • Sequence: atgggaaaccacgcaggcaaacgagaattaaatgccgagaaggccagtacgaatagtgaaactaacagaggagaatctgaaaaaaagagaaacctgggtgaactttcacggacaacctcagaggacaacgaagtgttcggagaggcagatgcgaaccagaacaatgggacctcctc
  • Show more
Description: A cloning plasmid for the MBP gene.

MBP Polyclonal Antibody

ABP59233-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody

ABP59233-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody

ABP59233-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of MBP from Human, Mouse, Rat. This MBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MBP protein at amino acid sequence of 180-260

MBP Polyclonal Antibody

ES8978-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MBP Polyclonal Antibody

ES8978-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-MBP (3G1A3)

LF-MA30179 100 ul
EUR 486
Description: Mouse Monoclonal to MBP

anti-MBP (2H9)

LF-MA30651 100 ul
EUR 527
Description: Mouse Monoclonal to MBP

pCold- MBP Plasmid

PVT0609 2 ug
EUR 325

pET22b-OmpK-MBP

PVT18035 2 ug
EUR 341