MBTPS2

MBTPS2 siRNA

20-abx923690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MBTPS2 antibody

70R-35582 100 ug
EUR 327.00
Description: Purified Rabbit polyclonal MBTPS2 antibody

MBTPS2 Antibody

CSB-PA905280-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MBTPS2. Recognizes MBTPS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

MBTPS2 Antibody

CSB-PA905280-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MBTPS2. Recognizes MBTPS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

MBTPS2 Antibody

34784-100ul 100ul
EUR 252.00

MBTPS2 Antibody

34784-50ul 50ul
EUR 187.00

MBTPS2 Antibody

1-CSB-PA020285
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MBTPS2. Recognizes MBTPS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

MBTPS2 Conjugated Antibody

C34784 100ul
EUR 397.00

MBTPS2 Blocking Peptide

20-abx162575
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MBTPS2 cloning plasmid

CSB-CL013557HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 993
  • Sequence: atgattccggtgtcgctggtggtggtggtggtgggtggctggactgtcgtctacctgaccgacttggtgctggagtcatctgtctattttaaacattcttatgaagactggctggaaaacaacggactgagcatctcccctttccacataagatggcaaactgctgttttcaatcg
  • Show more
Description: A cloning plasmid for the MBTPS2 gene.

Anti-MBTPS2 (1A3)

YF-MA18490 100 ug
EUR 363.00
Description: Mouse monoclonal to MBTPS2

Anti-MBTPS2/S2P Antibody

A07369-1 100ul
EUR 397.00
Description: Rabbit Polyclonal MBTPS2/S2P Antibody. Validated in IF and tested in Human, Mouse, Rat.

Human MBTPS2 ELISA KIT

ELI-20525h 96 Tests
EUR 824.00

Mouse Mbtps2 ELISA KIT

ELI-22767m 96 Tests
EUR 865.00

Bovine MBTPS2 ELISA KIT

ELI-37308b 96 Tests
EUR 928.00

Human MBTPS2 shRNA Plasmid

20-abx959719
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MBTPS2 shRNA Plasmid

20-abx983111
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MBTPS2 Recombinant Protein (Human)

RP018940 100 ug Ask for price

MBTPS2 Recombinant Protein (Rat)

RP211061 100 ug Ask for price

MBTPS2 Recombinant Protein (Mouse)

RP149747 100 ug Ask for price

MBTPS2 ORF Vector (Human) (pORF)

ORF006314 1.0 ug DNA
EUR 95.00

Mbtps2 ORF Vector (Mouse) (pORF)

ORF049917 1.0 ug DNA
EUR 506.00

Mbtps2 ORF Vector (Rat) (pORF)

ORF070355 1.0 ug DNA
EUR 506.00

Polyclonal MBTPS2 Antibody (N-term)

APR08360G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MBTPS2 (N-term). This antibody is tested and proven to work in the following applications:

Mbtps2 sgRNA CRISPR Lentivector set (Rat)

K6738001 3 x 1.0 ug
EUR 339.00

MBTPS2 sgRNA CRISPR Lentivector set (Human)

K1276701 3 x 1.0 ug
EUR 339.00

Mbtps2 sgRNA CRISPR Lentivector set (Mouse)

K4869901 3 x 1.0 ug
EUR 339.00

Mbtps2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6738002 1.0 ug DNA
EUR 154.00

Mbtps2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6738003 1.0 ug DNA
EUR 154.00

Mbtps2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6738004 1.0 ug DNA
EUR 154.00

MBTPS2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1276702 1.0 ug DNA
EUR 154.00

MBTPS2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1276703 1.0 ug DNA
EUR 154.00

MBTPS2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1276704 1.0 ug DNA
EUR 154.00

MBTPS2 Protein Vector (Rat) (pPB-C-His)

PV281418 500 ng
EUR 603.00

MBTPS2 Protein Vector (Rat) (pPB-N-His)

PV281419 500 ng
EUR 603.00

MBTPS2 Protein Vector (Rat) (pPM-C-HA)

PV281420 500 ng
EUR 603.00

MBTPS2 Protein Vector (Rat) (pPM-C-His)

PV281421 500 ng
EUR 603.00

MBTPS2 3'UTR GFP Stable Cell Line

TU063087 1.0 ml
EUR 2333.00

MBTPS2 3'UTR Luciferase Stable Cell Line

TU013087 1.0 ml
EUR 2333.00

Mbtps2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4869902 1.0 ug DNA
EUR 154.00

Mbtps2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4869903 1.0 ug DNA
EUR 154.00

Mbtps2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4869904 1.0 ug DNA
EUR 154.00

MBTPS2 Protein Vector (Mouse) (pPB-C-His)

PV199666 500 ng
EUR 603.00

MBTPS2 Protein Vector (Mouse) (pPB-N-His)

PV199667 500 ng
EUR 603.00

MBTPS2 Protein Vector (Mouse) (pPM-C-HA)

PV199668 500 ng
EUR 603.00

MBTPS2 Protein Vector (Mouse) (pPM-C-His)

PV199669 500 ng
EUR 603.00

Mbtps2 3'UTR GFP Stable Cell Line

TU162975 1.0 ml Ask for price

Mbtps2 3'UTR GFP Stable Cell Line

TU262941 1.0 ml Ask for price

Mbtps2 3'UTR Luciferase Stable Cell Line

TU112975 1.0 ml Ask for price

Mbtps2 3'UTR Luciferase Stable Cell Line

TU212941 1.0 ml Ask for price

MBTPS2 Protein Vector (Human) (pPB-C-His)

PV025253 500 ng
EUR 329.00

MBTPS2 Protein Vector (Human) (pPB-N-His)

PV025254 500 ng
EUR 329.00

MBTPS2 Protein Vector (Human) (pPM-C-HA)

PV025255 500 ng
EUR 329.00

MBTPS2 Protein Vector (Human) (pPM-C-His)

PV025256 500 ng
EUR 329.00

MBTPS2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV624325 1.0 ug DNA
EUR 682.00

MBTPS2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV624329 1.0 ug DNA
EUR 682.00

MBTPS2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV624330 1.0 ug DNA
EUR 682.00

Membrane Bound Transcription Factor Peptidase, Site 2 (MBTPS2) Antibody

20-abx014578
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Membrane Bound Transcription Factor Peptidase, Site 2 (MBTPS2) Antibody

20-abx326369
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Bound Transcription Factor Peptidase, Site 2 (MBTPS2) Antibody

abx331297-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Membrane Bound Transcription Factor Peptidase, Site 2 (MBTPS2) Antibody

20-abx121641
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6738005 3 x 1.0 ug
EUR 376.00

MBTPS2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1276705 3 x 1.0 ug
EUR 376.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4869905 3 x 1.0 ug
EUR 376.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6738006 1.0 ug DNA
EUR 167.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6738007 1.0 ug DNA
EUR 167.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6738008 1.0 ug DNA
EUR 167.00

MBTPS2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV624326 1.0 ug DNA
EUR 682.00

MBTPS2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV624327 1.0 ug DNA
EUR 740.00

MBTPS2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV624328 1.0 ug DNA
EUR 740.00

MBTPS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1276706 1.0 ug DNA
EUR 167.00

MBTPS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1276707 1.0 ug DNA
EUR 167.00

MBTPS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1276708 1.0 ug DNA
EUR 167.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4869906 1.0 ug DNA
EUR 167.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4869907 1.0 ug DNA
EUR 167.00

Mbtps2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4869908 1.0 ug DNA
EUR 167.00