MGAT1 antibody

70R-18498 50 ul
EUR 435
Description: Rabbit polyclonal MGAT1 antibody

MGAT1 Antibody

DF12658 200ul
EUR 304
Description: MGAT1 Antibody detects endogenous levels of MGAT1.

MGAT1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MGAT1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MGAT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13141 50 ug
EUR 363
Description: Mouse polyclonal to MGAT1

MGAT1 Polyclonal Antibody

30716-100ul 100ul
EUR 252

MGAT1 Polyclonal Antibody

30716-50ul 50ul
EUR 187

MGAT1 Polyclonal Antibody

27700-100ul 100ul
EUR 252

MGAT1 Polyclonal Antibody

27700-50ul 50ul
EUR 187

MGAT1 Rabbit pAb

A12459-100ul 100 ul
EUR 308

MGAT1 Rabbit pAb

A12459-200ul 200 ul
EUR 459

MGAT1 Rabbit pAb

A12459-20ul 20 ul
EUR 183

MGAT1 Rabbit pAb

A12459-50ul 50 ul
EUR 223

MGAT1 Blocking Peptide

DF12658-BP 1mg
EUR 195

MGAT1 cloning plasmid

CSB-CL013773HU-10ug 10ug
EUR 485
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atgctgaagaagcagtctgcagggcttgtgctgtggggcgctatcctctttgtggcctggaatgccctgctgctcctcttcttctggacgcgcccagcacctggcaggccaccctcagtcagcgctctcgatggcgaccccgccagcctcacccgggaagtgattcgcctggccc
  • Show more
Description: A cloning plasmid for the MGAT1 gene.

MGAT1 Rabbit pAb

A6387-100ul 100 ul
EUR 308

MGAT1 Rabbit pAb

A6387-200ul 200 ul
EUR 459

MGAT1 Rabbit pAb

A6387-20ul 20 ul
EUR 183

MGAT1 Rabbit pAb

A6387-50ul 50 ul
EUR 223

anti- MGAT1 antibody

FNab05156 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: mannosyl (alpha-1, 3-)-glycoprotein beta-1, 2-N-acetylglucosaminyltransferase
  • Uniprot ID: P26572
  • Gene ID: 4245
  • Research Area: Metabolism
Description: Antibody raised against MGAT1

Anti-MGAT1 antibody

PAab05156 100 ug
EUR 355

pDONR223-MGAT1 Plasmid

PVTB00914 2 ug
EUR 356

Anti-MGAT1 antibody

STJ28470 100 µl
EUR 277
Description: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene.

Anti-MGAT1 antibody

STJ114333 100 µl
EUR 277
Description: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene.

Anti-MGAT1 antibody

STJ72345 100 µg
EUR 359

Anti-MGAT1 (2G4)

YF-MA14238 200 ul
EUR 363
Description: Mouse monoclonal to MGAT1


ELI-15730h 96 Tests
EUR 824


EF000771 96 Tests
EUR 689

Rat MGAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MGAT1 Polyclonal Conjugated Antibody

C27700 100ul
EUR 397

MGAT1 Polyclonal Conjugated Antibody

C30716 100ul
EUR 397

Human MGAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MGAT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Mgat1 ELISA KIT

ELI-36639m 96 Tests
EUR 865

MGAT1 Recombinant Protein (Human)

RP019291 100 ug Ask for price

MGAT1 Recombinant Protein (Mouse)

RP150488 100 ug Ask for price

MGAT1 Recombinant Protein (Mouse)

RP150491 100 ug Ask for price

MGAT1 Recombinant Protein (Mouse)

RP150494 100 ug Ask for price

MGAT1 Recombinant Protein (Mouse)

RP150497 100 ug Ask for price

MGAT1 Recombinant Protein (Rat)

RP211568 100 ug Ask for price

Polyclonal MGAT1 Antibody (internal region)

APR17376G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MGAT1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MGAT1 Antibody (N-term)

APR17377G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MGAT1 (N-term). This antibody is tested and proven to work in the following applications:

Mgat1 ORF Vector (Rat) (pORF)

ORF070524 1.0 ug DNA
EUR 506

MGAT1 ORF Vector (Human) (pORF)

ORF006431 1.0 ug DNA
EUR 95

Mgat1 ORF Vector (Mouse) (pORF)

ORF050164 1.0 ug DNA
EUR 506

Mgat1 ORF Vector (Mouse) (pORF)

ORF050165 1.0 ug DNA
EUR 506

Mgat1 ORF Vector (Mouse) (pORF)

ORF050166 1.0 ug DNA
EUR 506

Mgat1 ORF Vector (Mouse) (pORF)

ORF050167 1.0 ug DNA
EUR 506

Mgat1 sgRNA CRISPR Lentivector set (Rat)

K7036401 3 x 1.0 ug
EUR 339

MGAT1 sgRNA CRISPR Lentivector set (Human)

K1298201 3 x 1.0 ug
EUR 339

Mgat1 sgRNA CRISPR Lentivector set (Mouse)

K3902701 3 x 1.0 ug
EUR 339

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7036402 1.0 ug DNA
EUR 154

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7036403 1.0 ug DNA
EUR 154

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7036404 1.0 ug DNA
EUR 154

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1298202 1.0 ug DNA
EUR 154

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1298203 1.0 ug DNA
EUR 154

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1298204 1.0 ug DNA
EUR 154

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3902702 1.0 ug DNA
EUR 154

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3902703 1.0 ug DNA
EUR 154

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3902704 1.0 ug DNA
EUR 154

MGAT1 Protein Vector (Mouse) (pPB-C-His)

PV200654 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-N-His)

PV200655 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-HA)

PV200656 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-His)

PV200657 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-C-His)

PV200658 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-N-His)

PV200659 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-HA)

PV200660 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-His)

PV200661 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-C-His)

PV200662 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-N-His)

PV200663 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-HA)

PV200664 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-His)

PV200665 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-C-His)

PV200666 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPB-N-His)

PV200667 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-HA)

PV200668 500 ng
EUR 603

MGAT1 Protein Vector (Mouse) (pPM-C-His)

PV200669 500 ng
EUR 603

MGAT1 Protein Vector (Rat) (pPB-C-His)

PV282094 500 ng
EUR 603

MGAT1 Protein Vector (Rat) (pPB-N-His)

PV282095 500 ng
EUR 603

MGAT1 Protein Vector (Rat) (pPM-C-HA)

PV282096 500 ng
EUR 603

MGAT1 Protein Vector (Rat) (pPM-C-His)

PV282097 500 ng
EUR 603

MGAT1 Protein Vector (Human) (pPB-C-His)

PV025721 500 ng
EUR 329

MGAT1 Protein Vector (Human) (pPB-N-His)

PV025722 500 ng
EUR 329

MGAT1 Protein Vector (Human) (pPM-C-HA)

PV025723 500 ng
EUR 329

MGAT1 Protein Vector (Human) (pPM-C-His)

PV025724 500 ng
EUR 329

Mgat1 3'UTR Luciferase Stable Cell Line

TU113166 1.0 ml Ask for price

Mgat1 3'UTR GFP Stable Cell Line

TU163166 1.0 ml Ask for price

Mgat1 3'UTR Luciferase Stable Cell Line

TU213128 1.0 ml Ask for price

Mgat1 3'UTR GFP Stable Cell Line

TU263128 1.0 ml Ask for price

MGAT1 3'UTR GFP Stable Cell Line

TU063314 1.0 ml
EUR 1521

MGAT1 3'UTR Luciferase Stable Cell Line

TU013314 1.0 ml
EUR 1521

MGAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV685825 1.0 ug DNA
EUR 682