MGAT1 antibody
70R-18498	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal MGAT1 antibody

MGAT1 Antibody
DF12658	Affbiotech	200ul	EUR 304.00
Description: MGAT1 Antibody detects endogenous levels of MGAT1.

MGAT1 Antibody
1-CSB-PA013773ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MGAT1 Antibody
1-CSB-PA013773ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MGAT1 Antibody
1-CSB-PA013773GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MGAT1. Recognizes MGAT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF

MGAT1 siRNA
20-abx903240	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

MGAT1 siRNA
20-abx924081	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

MGAT1 siRNA
20-abx924082	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-MGAT1
YF-PA13141	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to MGAT1

MGAT1 Polyclonal Antibody
30716-100ul	SAB	100ul	EUR 252.00

MGAT1 Polyclonal Antibody
30716-50ul	SAB	50ul	EUR 187.00

MGAT1 Polyclonal Antibody
27700-100ul	SAB	100ul	EUR 252.00

MGAT1 Polyclonal Antibody
27700-50ul	SAB	50ul	EUR 187.00

MGAT1 Rabbit pAb
A12459-100ul	Abclonal	100 ul	EUR 308.00

MGAT1 Rabbit pAb
A12459-200ul	Abclonal	200 ul	EUR 459.00

MGAT1 Rabbit pAb
A12459-20ul	Abclonal	20 ul	EUR 183.00

MGAT1 Rabbit pAb
A12459-50ul	Abclonal	50 ul	EUR 223.00

MGAT1 Blocking Peptide
DF12658-BP	Affbiotech	1mg	EUR 195.00

MGAT1 cloning plasmid
CSB-CL013773HU-10ug	Cusabio	10ug	EUR 485.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1338 Sequence: atgctgaagaagcagtctgcagggcttgtgctgtggggcgctatcctctttgtggcctggaatgccctgctgctcctcttcttctggacgcgcccagcacctggcaggccaccctcagtcagcgctctcgatggcgaccccgccagcctcacccgggaagtgattcgcctggccc Show more
Description: A cloning plasmid for the MGAT1 gene.

MGAT1 Rabbit pAb
A6387-100ul	Abclonal	100 ul	EUR 308.00

MGAT1 Rabbit pAb
A6387-200ul	Abclonal	200 ul	EUR 459.00

MGAT1 Rabbit pAb
A6387-20ul	Abclonal	20 ul	EUR 183.00

MGAT1 Rabbit pAb
A6387-50ul	Abclonal	50 ul	EUR 223.00

anti- MGAT1 antibody
FNab05156	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: mannosyl (alpha-1, 3-)-glycoprotein beta-1, 2-N-acetylglucosaminyltransferase Uniprot ID: P26572 Gene ID: 4245 Research Area: Metabolism
Description: Antibody raised against MGAT1

Anti-MGAT1 antibody
PAab05156	Lifescience Market	100 ug	EUR 355.00

pDONR223-MGAT1 Plasmid
PVTB00914	Lifescience Market	2 ug	EUR 356.00

Anti-MGAT1 antibody
STJ28470	St John's Laboratory	100 µl	EUR 277.00
Description: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene.

Anti-MGAT1 antibody
STJ114333	St John's Laboratory	100 µl	EUR 277.00
Description: There are believed to be over 100 different glycosyltransferases involved in the synthesis of protein-bound and lipid-bound oligosaccharides. UDP-N-acetylglucosamine:alpha-3-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I is a medial-Golgi enzyme essential for the synthesis of hybrid and complex N-glycans. The protein, encoded by a single exon, shows typical features of a type II transmembrane protein. The protein is believed to be essential for normal embryogenesis. Several variants encoding the same protein have been found for this gene.

Anti-MGAT1 antibody
STJ72345	St John's Laboratory	100 µg	EUR 359.00

Anti-MGAT1 (2G4)
YF-MA14238	Abfrontier	200 ul	EUR 363.00
Description: Mouse monoclonal to MGAT1

Human MGAT1 ELISA KIT
ELI-15730h	Lifescience Market	96 Tests	EUR 824.00

MGAT1 ELISA KIT|Human
EF000771	Lifescience Market	96 Tests	EUR 689.00

Rat MGAT1 shRNA Plasmid
20-abx986596	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

MGAT1 Polyclonal Conjugated Antibody
C27700	SAB	100ul	EUR 397.00

MGAT1 Polyclonal Conjugated Antibody
C30716	SAB	100ul	EUR 397.00

Human MGAT1 shRNA Plasmid
20-abx952885	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse MGAT1 shRNA Plasmid
20-abx971506	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse Mgat1 ELISA KIT
ELI-36639m	Lifescience Market	96 Tests	EUR 865.00

MGAT1 Recombinant Protein (Human)
RP019291	ABM	100 ug	Ask for price

MGAT1 Recombinant Protein (Mouse)
RP150488	ABM	100 ug	Ask for price

MGAT1 Recombinant Protein (Mouse)
RP150491	ABM	100 ug	Ask for price

MGAT1 Recombinant Protein (Mouse)
RP150494	ABM	100 ug	Ask for price

MGAT1 Recombinant Protein (Mouse)
RP150497	ABM	100 ug	Ask for price

MGAT1 Recombinant Protein (Rat)
RP211568	ABM	100 ug	Ask for price

Polyclonal MGAT1 Antibody (internal region)
APR17376G	Leading Biology	0.1 mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MGAT1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MGAT1 Antibody (N-term)
APR17377G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MGAT1 (N-term). This antibody is tested and proven to work in the following applications:

Mgat1 ORF Vector (Rat) (pORF)
ORF070524	ABM	1.0 ug DNA	EUR 506.00

MGAT1 ORF Vector (Human) (pORF)
ORF006431	ABM	1.0 ug DNA	EUR 95.00

Mgat1 ORF Vector (Mouse) (pORF)
ORF050164	ABM	1.0 ug DNA	EUR 506.00

Mgat1 ORF Vector (Mouse) (pORF)
ORF050165	ABM	1.0 ug DNA	EUR 506.00

Mgat1 ORF Vector (Mouse) (pORF)
ORF050166	ABM	1.0 ug DNA	EUR 506.00

Mgat1 ORF Vector (Mouse) (pORF)
ORF050167	ABM	1.0 ug DNA	EUR 506.00

Mgat1 sgRNA CRISPR Lentivector set (Rat)
K7036401	ABM	3 x 1.0 ug	EUR 339.00

MGAT1 sgRNA CRISPR Lentivector set (Human)
K1298201	ABM	3 x 1.0 ug	EUR 339.00

Mgat1 sgRNA CRISPR Lentivector set (Mouse)
K3902701	ABM	3 x 1.0 ug	EUR 339.00

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7036402	ABM	1.0 ug DNA	EUR 154.00

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7036403	ABM	1.0 ug DNA	EUR 154.00

Mgat1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7036404	ABM	1.0 ug DNA	EUR 154.00

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1298202	ABM	1.0 ug DNA	EUR 154.00

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1298203	ABM	1.0 ug DNA	EUR 154.00

MGAT1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1298204	ABM	1.0 ug DNA	EUR 154.00

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3902702	ABM	1.0 ug DNA	EUR 154.00

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3902703	ABM	1.0 ug DNA	EUR 154.00

Mgat1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3902704	ABM	1.0 ug DNA	EUR 154.00

MGAT1 Protein Vector (Mouse) (pPB-C-His)
PV200654	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-N-His)
PV200655	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-HA)
PV200656	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-His)
PV200657	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-C-His)
PV200658	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-N-His)
PV200659	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-HA)
PV200660	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-His)
PV200661	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-C-His)
PV200662	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-N-His)
PV200663	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-HA)
PV200664	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-His)
PV200665	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-C-His)
PV200666	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPB-N-His)
PV200667	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-HA)
PV200668	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Mouse) (pPM-C-His)
PV200669	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Rat) (pPB-C-His)
PV282094	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Rat) (pPB-N-His)
PV282095	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Rat) (pPM-C-HA)
PV282096	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Rat) (pPM-C-His)
PV282097	ABM	500 ng	EUR 603.00

MGAT1 Protein Vector (Human) (pPB-C-His)
PV025721	ABM	500 ng	EUR 329.00

MGAT1 Protein Vector (Human) (pPB-N-His)
PV025722	ABM	500 ng	EUR 329.00

MGAT1 Protein Vector (Human) (pPM-C-HA)
PV025723	ABM	500 ng	EUR 329.00

MGAT1 Protein Vector (Human) (pPM-C-His)
PV025724	ABM	500 ng	EUR 329.00

Mgat1 3'UTR Luciferase Stable Cell Line
TU113166	ABM	1.0 ml	Ask for price

Mgat1 3'UTR GFP Stable Cell Line
TU163166	ABM	1.0 ml	Ask for price

Mgat1 3'UTR Luciferase Stable Cell Line
TU213128	ABM	1.0 ml	Ask for price

Mgat1 3'UTR GFP Stable Cell Line
TU263128	ABM	1.0 ml	Ask for price

MGAT1 3'UTR GFP Stable Cell Line
TU063314	ABM	1.0 ml	EUR 1521.00

MGAT1 3'UTR Luciferase Stable Cell Line
TU013314	ABM	1.0 ml	EUR 1521.00

MGAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV685825	ABM	1.0 ug DNA	EUR 682.00