PABPC1

PABPC1 Antibody

1-CSB-PA829516
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PABPC1. Recognizes PABPC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PABPC1 Antibody

1-CSB-PA017352GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PABPC1. Recognizes PABPC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PABPC1 Antibody

36610-100ul 100ul
EUR 252.00

PABPC1 antibody

70R-4653 50 ug
EUR 467.00
Description: Rabbit polyclonal PABPC1 antibody

PABPC1 siRNA

20-abx903810
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PABPC1 siRNA

20-abx927575
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PABPC1 siRNA

20-abx927576
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PABPC1 Antibody

1-CSB-PA175056
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PABPC1. Recognizes PABPC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

pET15b-PABPC1

PVT12961 2 ug
EUR 703.00

PABPC1 Conjugated Antibody

C36610 100ul
EUR 397.00

PABPC1 cloning plasmid

CSB-CL017352HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1911
  • Sequence: atgaaccccagtgcccccagctaccccatggcctcgctctacgtgggggacctccaccccgacgtgaccgaggcgatgctctacgagaagttcagcccggccgggcccatcctctccatccgggtctgcagggacatgatcacccgccgctccttgggctacgcgtatgtgaact
  • Show more
Description: A cloning plasmid for the PABPC1 gene.

PABPC1 Blocking Peptide

33R-5379 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PABPC1 antibody, catalog no. 70R-4653

PABPC1,PABP Antibody

abx236096-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

PABPC1 Polyclonal Antibody

E-AB-11389-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and b
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PABPC1 for WB,ELISA applications.

PABPC1 Polyclonal Antibody

E-AB-11389-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and b
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PABPC1 for WB,ELISA applications.

PABPC1 Polyclonal Antibody

E-AB-11389-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and b
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PABPC1 for WB,ELISA applications.

Anti-PABPC1 antibody

STJ117072 100 µl
EUR 277.00
Description: This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.

Rat PABPC1 shRNA Plasmid

20-abx987739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PABPC1 shRNA Plasmid

20-abx971915
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PABPC1 protein (His tag)

80R-3949 250 ug
EUR 673.00
Description: Purified recombinant PABPC1 protein (His tag)

Human PABPC1 shRNA Plasmid

20-abx958910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-PABPC1,PABP antibody

PAab06096 100 ug
EUR 355.00

PABPC1 Recombinant Protein (Rat)

RP219107 100 ug Ask for price

PABPC1 Recombinant Protein (Human)

RP022399 100 ug Ask for price

PABPC1 Recombinant Protein (Mouse)

RP159830 100 ug Ask for price

anti- PABPC1,PABP antibody

FNab06096 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: poly(A) binding protein, cytoplasmic 1
  • Uniprot ID: P11940
  • Gene ID: 26986
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PABPC1,PABP

Rabbit pAbPC1 Rabbit pAb

A14872-100ul 100 ul
EUR 308.00

Rabbit pAbPC1 Rabbit pAb

A14872-200ul 200 ul
EUR 459.00

Rabbit pAbPC1 Rabbit pAb

A14872-20ul 20 ul
EUR 183.00

Rabbit pAbPC1 Rabbit pAb

A14872-50ul 50 ul
EUR 223.00

Human Polyadenylate-binding protein 1 (PABPC1) control (PABPC1- asymmetric methylated) peptide

AB-23051-P 100ug
EUR 164.00

PABPC1/PABP ELISA KIT|Human

EF001512 96 Tests
EUR 689.00

Pabpc1 ORF Vector (Rat) (pORF)

ORF073037 1.0 ug DNA
EUR 506.00

PABPC1 ORF Vector (Human) (pORF)

ORF007467 1.0 ug DNA
EUR 95.00

Pabpc1 ORF Vector (Mouse) (pORF)

ORF053278 1.0 ug DNA
EUR 506.00

Rabbit Anti-Human Polyadenylate-binding protein 1 (PABPC1) (PABPC1- asymmetric methylated) IgG (aff pure)

AB-23051-A 100ug
EUR 482.00

PABPC1 sgRNA CRISPR Lentivector set (Human)

K1584701 3 x 1.0 ug
EUR 339.00

Pabpc1 sgRNA CRISPR Lentivector set (Mouse)

K4752701 3 x 1.0 ug
EUR 339.00

Human Polyadenylate-binding protein 1 (PABPC1)

1-CSB-EP017352HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Polyadenylate-binding protein 1(PABPC1),partial expressed in E.coli

Pabpc1 sgRNA CRISPR Lentivector set (Rat)

K7079801 3 x 1.0 ug
EUR 339.00

PABPC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1584702 1.0 ug DNA
EUR 154.00

PABPC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1584703 1.0 ug DNA
EUR 154.00

PABPC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1584704 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4752702 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4752703 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4752704 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7079802 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7079803 1.0 ug DNA
EUR 154.00

Pabpc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7079804 1.0 ug DNA
EUR 154.00

PABPC1 Protein Vector (Human) (pPB-C-His)

PV029865 500 ng
EUR 329.00

PABPC1 Protein Vector (Human) (pPB-N-His)

PV029866 500 ng
EUR 329.00

PABPC1 Protein Vector (Human) (pPM-C-HA)

PV029867 500 ng
EUR 329.00

PABPC1 Protein Vector (Human) (pPM-C-His)

PV029868 500 ng
EUR 329.00

PABPC1 3'UTR Luciferase Stable Cell Line

TU017279 1.0 ml
EUR 1521.00

Pabpc1 3'UTR GFP Stable Cell Line

TU165827 1.0 ml Ask for price