PFDN5

PFDN5 Antibody

1-CSB-PA01414A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

PFDN5 Antibody

1-CSB-PA01415A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PFDN5 siRNA

20-abx928309
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PFDN5 siRNA

20-abx928310
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PFDN5 antibody

70R-19227 50 ul
EUR 435.00
Description: Rabbit polyclonal PFDN5 antibody

PFDN5 antibody

70R-15124 100 ug
EUR 327.00
Description: Rabbit polyclonal PFDN5 antibody

anti-PFDN5

YF-PA13732 50 ul
EUR 363.00
Description: Mouse polyclonal to PFDN5

anti-PFDN5

YF-PA13733 50 ug
EUR 363.00
Description: Mouse polyclonal to PFDN5

anti-PFDN5

YF-PA24348 50 ul
EUR 334.00
Description: Mouse polyclonal to PFDN5

PFDN5 Polyclonal Antibody

A51513 100 µg
EUR 570.55
Description: Ask the seller for details

PFDN5 Polyclonal Antibody

A51557 100 µg
EUR 570.55
Description: kits suitable for this type of research

PFDN5 cloning plasmid

CSB-CL017815HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 465
  • Sequence: atggcgcagtctattaacatcacggagctgaatctgccgcagctagaaatgctcaagaaccagctggaccaggaagtggagttcttgtccacgtccattgctcagctcaaagtggtacagaccaagtatgtggaagccaaggactgtctgaacgtgctgaacaagagcaacgaggg
  • Show more
Description: A cloning plasmid for the PFDN5 gene.

PFDN5 Polyclonal Antibody

30512-100ul 100ul
EUR 252.00

PFDN5 Polyclonal Antibody

30512-50ul 50ul
EUR 187.00

PFDN5 antibody (HRP)

60R-1219 100 ug
EUR 327.00
Description: Rabbit polyclonal PFDN5 antibody (HRP)

PFDN5 antibody (FITC)

60R-1220 100 ug
EUR 327.00
Description: Rabbit polyclonal PFDN5 antibody (FITC)

PFDN5 antibody (biotin)

60R-1221 100 ug
EUR 327.00
Description: Rabbit polyclonal PFDN5 antibody (biotin)

Anti-PFDN5 antibody

PAab06337 100 ug
EUR 386.00

pCMV-SPORT6-PFDN5

PVT12400 2 ug
EUR 391.00

anti- PFDN5 antibody

FNab06337 100µg
EUR 548.75
  • Immunogen: prefoldin subunit 5
  • Uniprot ID: Q99471
  • Gene ID: 5204
  • Research Area: Metabolism
Description: Antibody raised against PFDN5

Human PFDN5 Antibody

33278-05111 150 ug
EUR 261.00

PFDN5 Rabbit pAb

A4014-100ul 100 ul
EUR 308.00

PFDN5 Rabbit pAb

A4014-200ul 200 ul
EUR 459.00

PFDN5 Rabbit pAb

A4014-20ul 20 ul
EUR 183.00

PFDN5 Rabbit pAb

A4014-50ul 50 ul
EUR 223.00

Anti-PFDN5 antibody

STJ116227 100 µl
EUR 277.00
Description: This gene encodes a member of the prefoldin alpha subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. The encoded protein may also repress the transcriptional activity of the proto-oncogene c-Myc. Alternatively spliced transcript variants encoding different isoforms have been described.

PFDN5 Antibody, HRP conjugated

1-CSB-PA01414B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN5 Antibody, FITC conjugated

1-CSB-PA01414C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN5 Antibody, Biotin conjugated

1-CSB-PA01414D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PFDN5 Antibody, HRP conjugated

1-CSB-PA01415B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN5 Antibody, FITC conjugated

1-CSB-PA01415C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN5 Antibody, Biotin conjugated

1-CSB-PA01415D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN5. Recognizes PFDN5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse PFDN5 shRNA Plasmid

20-abx974842
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PFDN5 protein (His tag)

80R-1922 100 ug
EUR 305.00
Description: Purified recombinant PFDN5 protein

Human PFDN5 shRNA Plasmid

20-abx953475
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PFDN5 Polyclonal Conjugated Antibody

C30512 100ul
EUR 397.00

PFDN5 ELISA KIT|Human

EF001700 96 Tests
EUR 689.00

PFDN5 Recombinant Protein (Rat)

RP220130 100 ug Ask for price

PFDN5 Recombinant Protein (Human)

RP023167 100 ug Ask for price

pECMV-3-FLAG-PFDN5

PVT12965 2 ug
EUR 703.00

PFDN5 Recombinant Protein (Mouse)

RP161450 100 ug Ask for price

Polyclonal PFDN5 / MM1 Antibody

AMM07109G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN5 / MM1 . This antibody is tested and proven to work in the following applications:

Polyclonal PFDN5 / MM1 Antibody

AMM07110G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN5 / MM1 . This antibody is tested and proven to work in the following applications:

Human Prefoldin subunit 5 (PFDN5)

1-CSB-RP014144h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prefoldin subunit 5(PFDN5) expressed in E.coli

PFDN5 Polyclonal Antibody, HRP Conjugated

A51514 100 µg
EUR 570.55
Description: The best epigenetics products

PFDN5 Polyclonal Antibody, FITC Conjugated

A51515 100 µg
EUR 570.55
Description: kits suitable for this type of research

PFDN5 Polyclonal Antibody, Biotin Conjugated

A51516 100 µg
EUR 570.55
Description: fast delivery possible

PFDN5 Polyclonal Antibody, HRP Conjugated

A51558 100 µg
EUR 570.55
Description: fast delivery possible

PFDN5 Polyclonal Antibody, FITC Conjugated

A51559 100 µg
EUR 570.55
Description: reagents widely cited

PFDN5 Polyclonal Antibody, Biotin Conjugated

A51560 100 µg
EUR 570.55
Description: Ask the seller for details

Prefoldin Subunit 5 (PFDN5) Antibody

abx027222-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Prefoldin Subunit 5 (PFDN5) Antibody

abx027222-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Prefoldin Subunit 5 (PFDN5) Antibody

20-abx002945
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prefoldin Subunit 5 (PFDN5) Antibody

20-abx110111
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prefoldin Subunit 5 (PFDN5) Antibody

20-abx110112
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.