PIAS3

PIAS3 siRNA

20-abx904008
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS3 Antibody

AF0274 200ul
EUR 304
Description: PIAS3 antibody detects endogenous levels of total PIAS3.

PIAS3 Antibody

ABF0274 100 ug
EUR 438

PIAS3 siRNA

20-abx928536
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS3 siRNA

20-abx928537
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS3 antibody

70R-50794 100 ul
EUR 244
Description: Purified Polyclonal PIAS3 antibody

PIAS3 antibody

70R-30797 100 ug
EUR 327
Description: Rabbit polyclonal PIAS3 antibody

PIAS3 Antibody

33517-100ul 100ul
EUR 252

PIAS3 Antibody

33517-50ul 50ul
EUR 187

PIAS3 Antibody

25113-100ul 100ul
EUR 390

PIAS3 antibody

70R-19277 50 ul
EUR 435
Description: Rabbit polyclonal PIAS3 antibody

PIAS3 Antibody

1-CSB-PA896765DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PIAS3. Recognizes PIAS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PIAS3 Antibody

1-CSB-PA003780
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PIAS3. Recognizes PIAS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

PIAS3 Antibody

CSB-PA283252-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS3. Recognizes PIAS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS3 Antibody

CSB-PA283252-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS3. Recognizes PIAS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS3 Antibody

1-CSB-PA017959GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PIAS3. Recognizes PIAS3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-PIAS3

YF-PA25567 50 ul
EUR 334
Description: Mouse polyclonal to PIAS3

Polyclonal PIAS3 Antibody

APR06629G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIAS3 . This antibody is tested and proven to work in the following applications:

PIAS3 Conjugated Antibody

C33517 100ul
EUR 397

PIAS3 Blocking Peptide

AF0274-BP 1mg
EUR 195

anti- PIAS3 antibody

FNab06430 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: protein inhibitor of activated STAT, 3
  • Uniprot ID: Q9Y6X2
  • Gene ID: 10401
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PIAS3

PIAS3 Blocking Peptide

20-abx063669
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PIAS3 Rabbit pAb

A7060-100ul 100 ul
EUR 308

PIAS3 Rabbit pAb

A7060-200ul 200 ul
EUR 459

PIAS3 Rabbit pAb

A7060-20ul 20 ul
EUR 183

PIAS3 Rabbit pAb

A7060-50ul 50 ul
EUR 223

Anti-PIAS3 Antibody

A02807 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for PIAS3 (PIAS3) detection. Tested with WB, IHC in Human, Mouse, Rat.

Anti-PIAS3 Antibody

A02807-1 100ug/vial
EUR 294

PIAS3 Rabbit pAb

A13394-100ul 100 ul
EUR 308

PIAS3 Rabbit pAb

A13394-200ul 200 ul
EUR 459

PIAS3 Rabbit pAb

A13394-20ul 20 ul
EUR 183

PIAS3 Rabbit pAb

A13394-50ul 50 ul
EUR 223

PIAS3 Polyclonal Antibody

42699-100ul 100ul
EUR 333

PIAS3 cloning plasmid

CSB-CL896765HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1860
  • Sequence: atggtgatgagtttccgggtgtctgagctccaggtgcttcttggctttgctggccggaacaagagtggacggaagcacgagctcctggccaaggctctgcacctcctgaagtccagctgtgcccctagtgtccagatgaagatcaaagagctttaccgacgacgctttccccgga
  • Show more
Description: A cloning plasmid for the PIAS3 gene.

Anti-PIAS3 antibody

PAab06430 100 ug
EUR 355

pENTR223-PIAS3 vector

PVT11795 2 ug
EUR 304

Anti-PIAS3 antibody

STJ29140 100 µl
EUR 277
Description: This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined.

Anti-PIAS3 antibody

STJ115356 100 µl
EUR 277
Description: This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)] family of transcriptional modulators. The protein functions as a SUMO (small ubiquitin-like modifier)-E3 ligase which catalyzes the covalent attachment of a SUMO protein to specific target substrates. It directly binds to several transcription factors and either blocks or enhances their activity. Alternatively spliced transcript variants of this gene have been identified, but the full-length nature of some of these variants has not been determined.

Anti-PIAS3 (4F12)

YF-MA17282 100 ug
EUR 363
Description: Mouse monoclonal to PIAS3

Mouse Pias3/ E3 SUMO-protein ligase PIAS3 ELISA Kit

E1133Mo 1 Kit
EUR 571

Human PIAS3/ E3 SUMO-protein ligase PIAS3 ELISA Kit

E1931Hu 1 Kit
EUR 571

Mouse E3 SUMO- protein ligase PIAS3, Pias3 ELISA KIT

ELI-05210m 96 Tests
EUR 865

Human E3 SUMO- protein ligase PIAS3, PIAS3 ELISA KIT

ELI-05211h 96 Tests
EUR 824

PIAS3 Cell ELISA Kit

abx595480-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Rat PIAS3 shRNA Plasmid

20-abx986815
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIAS3 ELISA KIT|Human

EF001769 96 Tests
EUR 689

Human PIAS3 shRNA Plasmid

20-abx957050
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PIAS3 shRNA Plasmid

20-abx981717
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIAS3 Recombinant Protein (Human)

RP023422 100 ug Ask for price

PIAS3 Recombinant Protein (Rat)

RP220442 100 ug Ask for price

pECMV-3-FLAG-PIAS3

PVT13390 2 ug
EUR 599

PIAS3 Recombinant Protein (Mouse)

RP161966 100 ug Ask for price

PIAS3 Recombinant Protein (Mouse)

RP161969 100 ug Ask for price

PIAS3 Recombinant Protein (Mouse)

RP161972 100 ug Ask for price

Polyclonal PIAS3 Antibody (C-Terminus)

APR02732G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIAS3 (C-Terminus). This antibody is tested and proven to work in the following applications: