PIAS4

PIAS4 Antibody

1-CSB-PA017960GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PIAS4 siRNA

20-abx928538
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS4 siRNA

20-abx928539
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIAS4 Antibody

25114-100ul 100ul
EUR 390.00

PIAS4 antibody

70R-30799 100 ug
EUR 327.00
Description: Rabbit polyclonal PIAS4 antibody

PIAS4 Antibody

ABF5329 100 ug
EUR 438.00

PIAS4 Antibody

33518-100ul 100ul
EUR 252.00

PIAS4 Antibody

33518-50ul 50ul
EUR 187.00

PIAS4 antibody

70R-19278 50 ul
EUR 435.00
Description: Rabbit polyclonal PIAS4 antibody

PIAS4 Antibody

1-CSB-PA030004
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PIAS4 Antibody

CSB-PA577177-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS4 Antibody

CSB-PA577177-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PIAS4 Antibody

AF5329 200ul
EUR 304.00
Description: PIAS4 Antibody detects endogenous levels of total PIAS4.

E3 SUMO-Protein Ligase PIAS4 (PIAS4) Antibody

abx026852-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

E3 SUMO-Protein Ligase PIAS4 (PIAS4) Antibody

abx026852-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

PIAS4 cloning plasmid

CSB-CL822692HU1-10ug 10ug
EUR 531.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1503
  • Sequence: atggtgatgagttttcgagtctccgaccttcagatgctcctgggtttcgtgggccggagtaagagtggactgaagcacgagctcgtcaccagggccctccagctggtgcagtttgactgtagccctgagctgttcaagaagatcaaggagctgtacgagacccgctacgccaaga
  • Show more
Description: A cloning plasmid for the PIAS4 gene.

PIAS4 cloning plasmid

CSB-CL822692HU2-10ug 10ug
EUR 539.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1533
  • Sequence: atggcggcggagctggtggaggccaaaaacatggtgatgagttttcgagtctccgaccttcagatgctcctgggtttcgtgggccggagtaagagtggactgaagcacgagctcgtcaccagggccctccagctggtgcagtttgactgtagccctgagctgttcaagaagatca
  • Show more
Description: A cloning plasmid for the PIAS4 gene.

PIAS4 cloning plasmid

CSB-CL822692HU3-10ug 10ug
EUR 331.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: ATGTACCTGTCCTCGGCCACCAACCGCATCACTGTCACCTGGGGGAACTACGGCAAGAGCTACTCGGTGGCCCTGTACCTGGTGCGGCAGCTGACCTCATCGGAGCTGCTGCAGAGGCTGAAGACCATTGGGGTAAAGCACCCGGAGCTGTGCAAGGCACTGGTCAAGGAGAAGCT
  • Show more
Description: A cloning plasmid for the PIAS4 gene.

PIAS4 Blocking Peptide

20-abx162645
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PIAS4 Conjugated Antibody

C33518 100ul
EUR 397.00

Anti-PIAS4 antibody

PAab06431 100 ug
EUR 355.00

Anti-PIAS4 antibody

PAab06432 100 ug
EUR 355.00

anti- PIAS4 antibody

FNab06431 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: protein inhibitor of activated STAT, 4
  • Uniprot ID: Q8N2W9
  • Gene ID: 51588
  • Research Area: Metabolism
Description: Antibody raised against PIAS4

anti- PIAS4 antibody

FNab06432 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:50-1:500
  • Immunogen: protein inhibitor of activated STAT, 4
  • Uniprot ID: Q8N2W9
  • Gene ID: 51588
  • Research Area: Metabolism
Description: Antibody raised against PIAS4

Recombinant Human PIAS4

P0312 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: Q8N2W9
Description: Recombinant Human protein for PIAS4

PIAS4 Blocking Peptide

AF5329-BP 1mg
EUR 195.00

PIAS4 Rabbit pAb

A5322-100ul 100 ul
EUR 308.00

PIAS4 Rabbit pAb

A5322-200ul 200 ul
EUR 459.00

PIAS4 Rabbit pAb

A5322-20ul 20 ul
EUR 183.00

PIAS4 Rabbit pAb

A5322-50ul 50 ul
EUR 223.00

Anti-PIAS4 antibody

STJ27275 100 µl
EUR 277.00

Mouse E3 SUMO- protein ligase PIAS4, Pias4 ELISA KIT

ELI-22000m 96 Tests
EUR 865.00

Human E3 SUMO- protein ligase PIAS4, PIAS4 ELISA KIT

ELI-37392h 96 Tests
EUR 824.00

PIAS4 Antibody, HRP conjugated

1-CSB-PA822692LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIAS4 Antibody, FITC conjugated

1-CSB-PA822692LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIAS4 Antibody, Biotin conjugated

1-CSB-PA822692LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse PIAS4 shRNA Plasmid

20-abx975134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIAS4 shRNA Plasmid

20-abx959846
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIAS4 Cell ELISA Kit

abx595481-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.

PIAS4 ELISA KIT|Human

EF001770 96 Tests
EUR 689.00

PIAS4 Recombinant Protein (Rat)

RP220445 100 ug Ask for price

PIAS4 Recombinant Protein (Human)

RP023425 100 ug Ask for price

PIAS4 Recombinant Protein (Human)

RP023428 100 ug Ask for price

PIAS4 Recombinant Protein (Human)

RP042211 100 ug Ask for price

pCMV-SPORT6-PIAS4 Plasmid

PVT16530 2 ug
EUR 325.00

PIAS4 Recombinant Protein (Mouse)

RP161975 100 ug Ask for price

Pias4 ORF Vector (Rat) (pORF)

ORF073483 1.0 ug DNA
EUR 506.00

PIAS4 ORF Vector (Human) (pORF)

ORF014071 1.0 ug DNA
EUR 354.00

PIAS4 ORF Vector (Human) (pORF)

ORF007809 1.0 ug DNA
EUR 95.00

PIAS4 ORF Vector (Human) (pORF)

ORF007810 1.0 ug DNA
EUR 95.00

Pias4 ORF Vector (Mouse) (pORF)

ORF053993 1.0 ug DNA
EUR 506.00

PIAS4 sgRNA CRISPR Lentivector set (Human)

K1646001 3 x 1.0 ug
EUR 339.00

Pias4 sgRNA CRISPR Lentivector set (Mouse)

K3744701 3 x 1.0 ug
EUR 339.00

PIAS4 Colorimetric Cell-Based ELISA Kit

EKC1459 100ul
EUR 572.00

Pias4 sgRNA CRISPR Lentivector set (Rat)

K6756001 3 x 1.0 ug
EUR 339.00