PIGN

PIGN Antibody

1-CSB-PA017977LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGN. Recognizes PIGN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

pBlueScriptR-PIGN

PVT17340 2 ug
EUR 258.00

PIGN cloning plasmid

CSB-CL017977HU-10ug 10ug
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2796
  • Sequence: atgctgctgttctttactttgggattgcttatacattttgtgttcttcgcctccatctttgacatttattttacatctcctttggttcatggaatgactcctcagtttacaccattgcctcctccagcgagaagattagtgttgtttgttgctgatggccttcgagcagatgcac
  • Show more
Description: A cloning plasmid for the PIGN gene.

Human PIGN shRNA Plasmid

20-abx958358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGN Antibody, HRP conjugated

1-CSB-PA017977LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGN. Recognizes PIGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGN Antibody, FITC conjugated

1-CSB-PA017977LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGN. Recognizes PIGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGN Antibody, Biotin conjugated

1-CSB-PA017977LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGN. Recognizes PIGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGN ORF Vector (Human) (pORF)

ORF007822 1.0 ug DNA
EUR 95.00

Pign ORF Vector (Mouse) (pORF)

ORF054017 1.0 ug DNA
EUR 506.00

Pign ORF Vector (Rat) (pORF)

ORF073496 1.0 ug DNA
EUR 506.00

Pign sgRNA CRISPR Lentivector set (Rat)

K6587901 3 x 1.0 ug
EUR 339.00

Pign sgRNA CRISPR Lentivector set (Mouse)

K4330001 3 x 1.0 ug
EUR 339.00

PIGN sgRNA CRISPR Lentivector set (Human)

K1647801 3 x 1.0 ug
EUR 339.00

Pign sgRNA CRISPR Lentivector (Rat) (Target 1)

K6587902 1.0 ug DNA
EUR 154.00

Pign sgRNA CRISPR Lentivector (Rat) (Target 2)

K6587903 1.0 ug DNA
EUR 154.00

Pign sgRNA CRISPR Lentivector (Rat) (Target 3)

K6587904 1.0 ug DNA
EUR 154.00

Pign sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4330002 1.0 ug DNA
EUR 154.00

Pign sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4330003 1.0 ug DNA
EUR 154.00

Pign sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4330004 1.0 ug DNA
EUR 154.00

PIGN Protein Vector (Rat) (pPB-C-His)

PV293982 500 ng
EUR 1191.00

PIGN Protein Vector (Rat) (pPB-N-His)

PV293983 500 ng
EUR 1191.00

PIGN Protein Vector (Rat) (pPM-C-HA)

PV293984 500 ng
EUR 1191.00

PIGN Protein Vector (Rat) (pPM-C-His)

PV293985 500 ng
EUR 1191.00

PIGN Protein Vector (Mouse) (pPB-C-His)

PV216066 500 ng
EUR 1065.00

PIGN Protein Vector (Mouse) (pPB-N-His)

PV216067 500 ng
EUR 1065.00

PIGN Protein Vector (Mouse) (pPM-C-HA)

PV216068 500 ng
EUR 1065.00

PIGN Protein Vector (Mouse) (pPM-C-His)

PV216069 500 ng
EUR 1065.00

PIGN 3'UTR GFP Stable Cell Line

TU067938 1.0 ml
EUR 1521.00

PIGN 3'UTR Luciferase Stable Cell Line

TU017938 1.0 ml
EUR 1521.00

PIGN sgRNA CRISPR Lentivector (Human) (Target 3)

K1647804 1.0 ug DNA
EUR 154.00

PIGN sgRNA CRISPR Lentivector (Human) (Target 1)

K1647802 1.0 ug DNA
EUR 154.00

PIGN sgRNA CRISPR Lentivector (Human) (Target 2)

K1647803 1.0 ug DNA
EUR 154.00

Pign 3'UTR GFP Stable Cell Line

TU266232 1.0 ml Ask for price

Pign 3'UTR GFP Stable Cell Line

TU166354 1.0 ml Ask for price

Pign 3'UTR Luciferase Stable Cell Line

TU216232 1.0 ml Ask for price

Pign 3'UTR Luciferase Stable Cell Line

TU116354 1.0 ml Ask for price

PIGN Protein Vector (Human) (pPB-C-His)

PV031285 500 ng
EUR 329.00

PIGN Protein Vector (Human) (pPB-N-His)

PV031286 500 ng
EUR 329.00

PIGN Protein Vector (Human) (pPM-C-HA)

PV031287 500 ng
EUR 329.00

PIGN Protein Vector (Human) (pPM-C-His)

PV031288 500 ng
EUR 329.00

PIGN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669979 1.0 ug DNA
EUR 1355.00

PIGN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669983 1.0 ug DNA
EUR 1355.00

PIGN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669984 1.0 ug DNA
EUR 1355.00

Mouse GPI ethanolamine phosphate transferase 1, Pign ELISA KIT

ELI-21598m 96 Tests
EUR 865.00

Human GPI ethanolamine phosphate transferase 1, PIGN ELISA KIT

ELI-22004h 96 Tests
EUR 824.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6587905 3 x 1.0 ug
EUR 376.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4330005 3 x 1.0 ug
EUR 376.00

PIGN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1647805 3 x 1.0 ug
EUR 376.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6587906 1.0 ug DNA
EUR 167.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6587907 1.0 ug DNA
EUR 167.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6587908 1.0 ug DNA
EUR 167.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4330006 1.0 ug DNA
EUR 167.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4330007 1.0 ug DNA
EUR 167.00

Pign sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4330008 1.0 ug DNA
EUR 167.00

PIGN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV669980 1.0 ug DNA
EUR 1355.00