PMPCB

PMPCB Antibody

1-CSB-PA018243ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PMPCB. Recognizes PMPCB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PMPCB Antibody

1-CSB-PA018243ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PMPCB. Recognizes PMPCB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PMPCB Antibody

1-CSB-PA018243GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PMPCB. Recognizes PMPCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PMPCB siRNA

20-abx929051
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMPCB siRNA

20-abx929052
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMPCB Antibody

36698-100ul 100ul
EUR 252.00

PMPCB antibody

70R-19370 50 ul
EUR 435.00
Description: Rabbit polyclonal PMPCB antibody

PMPCB siRNA

20-abx904104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMPCB Antibody

1-CSB-PA280859
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PMPCB. Recognizes PMPCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PMPCB Antibody

1-CSB-PA560275
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PMPCB. Recognizes PMPCB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

anti-PMPCB

YF-PA25354 50 ul
EUR 334.00
Description: Mouse polyclonal to PMPCB

PMPCB Antibody

DF12305 200ul
EUR 304.00
Description: PMPCB antibody detects endogenous levels of PMPCB.

PMPCB Conjugated Antibody

C36698 100ul
EUR 397.00

PMPCB cloning plasmid

CSB-CL018243HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1155
  • Sequence: atggctttcaagggcaccaagaagagatcccagttagatctggaacttgagattgaaaatatgggtgctcatctcaatgcctatacctccagagagcagactgtatactatgccaaagcattctctaaagacttgccaagagctgtagaaattcttgctgatataatacaaaaca
  • Show more
Description: A cloning plasmid for the PMPCB gene.

PMPCB cloning plasmid

CSB-CL018243HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1473
  • Sequence: atggcggctgcggcggctcgagtggtgttgtcatccgcggcgcggcggcggctctggggtttcagcgagagtcttctaatccgaggcgctgcgggacggtcattatattttggagagaacagattaagaagtacacaggctgctacccaagttgttctgaatgttcctgaaacaa
  • Show more
Description: A cloning plasmid for the PMPCB gene.

PMPCB Polyclonal Antibody

E-AB-11491-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This p
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PMPCB for WB,IHC,ELISA applications.

PMPCB Polyclonal Antibody

E-AB-11491-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This p
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PMPCB for WB,IHC,ELISA applications.

PMPCB Polyclonal Antibody

E-AB-11491-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This p
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat PMPCB for WB,IHC,ELISA applications.

Anti-PMPCB antibody

PAab06576 100 ug
EUR 355.00

PMPCB Blocking Peptide

DF12305-BP 1mg
EUR 195.00

anti- PMPCB antibody

FNab06576 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: peptidase (mitochondrial processing) beta
  • Uniprot ID: O75439
  • Gene ID: 9512
  • Research Area: Metabolism
Description: Antibody raised against PMPCB

Anti-PMPCB (3C3)

YF-MA16891 100 ug
EUR 363.00
Description: Mouse monoclonal to PMPCB

PMPCB Rabbit pAb

A12549-100ul 100 ul
EUR 308.00

PMPCB Rabbit pAb

A12549-200ul 200 ul
EUR 459.00

PMPCB Rabbit pAb

A12549-20ul 20 ul
EUR 183.00

PMPCB Rabbit pAb

A12549-50ul 50 ul
EUR 223.00

PMPCB Rabbit pAb

A4312-100ul 100 ul
EUR 308.00

PMPCB Rabbit pAb

A4312-200ul 200 ul
EUR 459.00

PMPCB Rabbit pAb

A4312-20ul 20 ul
EUR 183.00

PMPCB Rabbit pAb

A4312-50ul 50 ul
EUR 223.00

Anti-PMPCB antibody

STJ114423 100 µl
EUR 277.00
Description: This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex.

Anti-PMPCB antibody

STJ26616 100 µl
EUR 277.00
Description: This gene is a member of the peptidase M16 family and encodes a protein with a zinc-binding motif. This protein is located in the mitochondrial matrix and catalyzes the cleavage of the leader peptides of precursor proteins newly imported into the mitochondria, though it only functions as part of a heterodimeric complex.

Mouse PMPCB shRNA Plasmid

20-abx977905
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PMPCB shRNA Plasmid

20-abx986183
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PMPCB shRNA Plasmid

20-abx956318
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PMPCB ELISA KIT|Human

EF001888 96 Tests
EUR 689.00

Bovine PMPCB ELISA KIT

ELI-43784b 96 Tests
EUR 928.00

Human PMPCB ELISA KIT

ELI-38537h 96 Tests
EUR 824.00

Mouse Pmpcb ELISA KIT

ELI-38538m 96 Tests
EUR 865.00

PMPCB Recombinant Protein (Rat)

RP221138 100 ug Ask for price

PMPCB Recombinant Protein (Human)

RP023908 100 ug Ask for price

PMPCB Recombinant Protein (Human)

RP023911 100 ug Ask for price

PMPCB Recombinant Protein (Mouse)

RP163088 100 ug Ask for price

Pmpcb ORF Vector (Rat) (pORF)

ORF073714 1.0 ug DNA
EUR 506.00

PMPCB ORF Vector (Human) (pORF)

ORF007970 1.0 ug DNA
EUR 95.00

PMPCB ORF Vector (Human) (pORF)

ORF007971 1.0 ug DNA
EUR 95.00

Pmpcb ORF Vector (Mouse) (pORF)

ORF054364 1.0 ug DNA
EUR 506.00

PMPCB sgRNA CRISPR Lentivector set (Human)

K1674101 3 x 1.0 ug
EUR 339.00

Pmpcb sgRNA CRISPR Lentivector set (Mouse)

K4915701 3 x 1.0 ug
EUR 339.00

Pmpcb sgRNA CRISPR Lentivector set (Rat)

K7041701 3 x 1.0 ug
EUR 339.00

Peptidase, Mitochondrial Processing Beta Subunit (PMPCB) Antibody

20-abx003204
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PMPCB sgRNA CRISPR Lentivector (Human) (Target 1)

K1674102 1.0 ug DNA
EUR 154.00

PMPCB sgRNA CRISPR Lentivector (Human) (Target 2)

K1674103 1.0 ug DNA
EUR 154.00

PMPCB sgRNA CRISPR Lentivector (Human) (Target 3)

K1674104 1.0 ug DNA
EUR 154.00

Peptidase, Mitochondrial Processing Beta Subunit (PMPCB) Antibody

20-abx241596
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.