PROS1

PROS1 siRNA

20-abx929890
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROS1 siRNA

20-abx929891
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PROS1 antibody

38263-100ul 100ul
EUR 252.00

PROS1 Antibody

ABD6487 100 ug
EUR 438.00

PROS1 Antibody

35990-100ul 100ul
EUR 252.00

PROS1 antibody

70R-19544 50 ul
EUR 435.00
Description: Rabbit polyclonal PROS1 antibody

PROS1 Antibody

1-CSB-PA121719
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

PROS1 Antibody

1-CSB-PA127412
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

PROS1 Antibody

1-CSB-PA018754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PROS1 Antibody

1-CSB-PA018754LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

PROS1 Antibody

DF6487 200ul
EUR 304.00
Description: PROS1 Antibody detects endogenous levels of total PROS1.

PROS1 Polyclonal Antibody

A56286 100 µg
EUR 570.55
Description: The best epigenetics products

PROS1 Polyclonal Antibody

E-AB-10681-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant
  • Show more
Description: Rabbit antibody against Human PROS1 for IHC,ELISA applications.

PROS1 Polyclonal Antibody

E-AB-10681-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant
  • Show more
Description: Rabbit antibody against Human PROS1 for IHC,ELISA applications.

PROS1 Polyclonal Antibody

E-AB-10681-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant
  • Show more
Description: Rabbit antibody against Human PROS1 for IHC,ELISA applications.

PROS1 Conjugated Antibody

C35990 100ul
EUR 397.00

PROS1 cloning plasmid

CSB-CL018754HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2031
  • Sequence: atgagggtcctgggtgggcgctgcggggcgctgctggcgtgtctcctcctagtgcttcccgtctcagaggcaaactttttgtcaaagcaacaggcttcacaagtcctggttaggaagcgtcgtgcaaattctttacttgaagaaaccaaacagggtaatcttgaaagagaatgca
  • Show more
Description: A cloning plasmid for the PROS1 gene.

pCMV-SPORT6-PROS1

PVT13113 2 ug
EUR 391.00

Anti-PROS1 antibody

PAab06803 100 ug
EUR 386.00

PROS1 Blocking Peptide

DF6487-BP 1mg
EUR 195.00

PROS1 Rabbit pAb

A1595-100ul 100 ul
EUR 308.00

PROS1 Rabbit pAb

A1595-200ul 200 ul
EUR 459.00

PROS1 Rabbit pAb

A1595-20ul 20 ul
EUR 183.00

PROS1 Rabbit pAb

A1595-50ul 50 ul
EUR 223.00

anti- PROS1 antibody

FNab06803 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: protein S(alpha)
  • Uniprot ID: P07225
  • Gene ID: 5627
  • Research Area: Cardiovascular
Description: Antibody raised against PROS1

Anti-PROS1 antibody

STJ25158 100 µl
EUR 277.00
Description: This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. It is found in plasma in both a free, functionally active form and also in an inactive form complexed with C4b-binding protein. Mutations in this gene result in autosomal dominant hereditary thrombophilia. An inactive pseudogene of this locus is located at an adjacent region on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein.

PROS1 ELISA KIT|Human

EF002695 96 Tests
EUR 689.00

Human PROS1 ELISA Kit

ELA-E1971h 96 Tests
EUR 824.00

Mouse PROS1 shRNA Plasmid

20-abx972219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PROS1 shRNA Plasmid

20-abx953793
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PROS1 Antibody, HRP conjugated

1-CSB-PA018754LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PROS1 Antibody, FITC conjugated

1-CSB-PA018754LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PROS1 Antibody, Biotin conjugated

1-CSB-PA018754LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PROS1. Recognizes PROS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PROS1 Recombinant Protein (Human)

RP024700 100 ug Ask for price

PROS1 Recombinant Protein (Rat)

RP222284 100 ug Ask for price

PROS1 Recombinant Protein (Mouse)

RP164756 100 ug Ask for price

Anti-Protein S/PROS1 Antibody

A01568-1 100ug/vial
EUR 294.00

PROS1 Polyclonal Antibody, HRP Conjugated

A56287 100 µg
EUR 570.55
Description: kits suitable for this type of research

PROS1 Polyclonal Antibody, FITC Conjugated

A56288 100 µg
EUR 570.55
Description: fast delivery possible

PROS1 Polyclonal Antibody, Biotin Conjugated

A56289 100 µg
EUR 570.55
Description: reagents widely cited

Human PROS1 PicoKine ELISA Kit

EK1739 96 wells
EUR 425.00
Description: For quantitative detection of human PROS1 in cell culture supernates, serum and plasma (heparin, EDTA).

PROS1 ORF Vector (Human) (pORF)

ORF008234 1.0 ug DNA
EUR 95.00

Pros1 ORF Vector (Mouse) (pORF)

ORF054920 1.0 ug DNA
EUR 506.00

Pros1 ORF Vector (Rat) (pORF)

ORF074096 1.0 ug DNA
EUR 506.00

Pros1 sgRNA CRISPR Lentivector set (Rat)

K7046201 3 x 1.0 ug
EUR 339.00

PROS1 sgRNA CRISPR Lentivector set (Human)

K1727001 3 x 1.0 ug
EUR 339.00

Pros1 sgRNA CRISPR Lentivector set (Mouse)

K3713501 3 x 1.0 ug
EUR 339.00

Polyclonal Pros1 antibody - C-terminal region

APR01311G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Pros1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Vitamin K-Dependent Protein S (PROS1) Antibody

abx236803-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Vitamin K-Dependent Protein S (PROS1) Antibody

abx019192-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

Vitamin K-Dependent Protein S (PROS1) Antibody

abx036485-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Vitamin K-dependent protein S (PROS1) Antibody

20-abx210319
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vitamin K-dependent protein S (PROS1) Antibody

20-abx210320
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vitamin K-Dependent Protein S (PROS1) Antibody

20-abx001343
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat Vitamin K-dependent protein S (Pros1)

1-CSB-MP018754RA
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 73.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Vitamin K-dependent protein S(Pros1) expressed in Mammalian cell