PSMA4

PSMA4 siRNA

20-abx904306
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA4 siRNA

20-abx930128
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA4 siRNA

20-abx930129
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA4 antibody

10R-5469 100 ul
EUR 726.00
Description: Mouse monoclonal PSMA4 antibody

PSMA4 antibody

10R-5470 100 ul
EUR 691.00
Description: Mouse monoclonal PSMA4 antibody

PSMA4 antibody

10R-5471 100 ul
EUR 691.00
Description: Mouse monoclonal PSMA4 antibody

PSMA4 antibody

10R-5472 100 ul
EUR 691.00
Description: Mouse monoclonal PSMA4 antibody

PSMA4 antibody

70R-4317 50 ug
EUR 467.00
Description: Rabbit polyclonal PSMA4 antibody

PSMA4 Antibody

ABD6976 100 ug
EUR 438.00

PSMA4 Antibody

32683-100ul 100ul
EUR 252.00

PSMA4 antibody

70R-19576 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMA4 antibody

PSMA4 Antibody

1-CSB-PA018869GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMA4. Recognizes PSMA4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMA4 Antibody

1-CSB-PA018869LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA4. Recognizes PSMA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-PSMA4

YF-PA24496 50 ul
EUR 334.00
Description: Mouse polyclonal to PSMA4

PSMA4 Antibody

DF6976 200ul
EUR 304.00
Description: PSMA4 Antibody detects endogenous levels of total PSMA4.

PSMA4 Blocking Peptide

33R-6994 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA4 antibody, catalog no. 70R-4317

PSMA4 cloning plasmid

CSB-CL018869HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atgtctcgaagatatgactccaggaccactatattttctccagaaggtcgcttataccaagttgaatatgccatggaagctattggacatgcaggcacctgtttgggaattttagcaaatgatggtgttttgcttgcagcagagagacgcaacatccacaagcttcttgatgaagt
  • Show more
Description: A cloning plasmid for the PSMA4 gene.

PSMA4 cloning plasmid

CSB-CL018869HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atggaagctattggacatgcaggcacctgtttgggaattttagcaaatgatggtgttttgcttgcagcagagagacgcaacatccacaagcttcttgatgaagtctttttttctgaaaaaatttataaactcaatgaggacatggcttgcagtgtggcaggcataacttctgatgc
  • Show more
Description: A cloning plasmid for the PSMA4 gene.

PSMA4 Conjugated Antibody

C32683 100ul
EUR 397.00

Anti-PSMA4 antibody

PAab06864 100 ug
EUR 355.00

Anti-PSMA4 Antibody

PB10090 100ug/vial
EUR 294.00

PSMA4 Blocking Peptide

DF6976-BP 1mg
EUR 195.00

PSMA4 Rabbit pAb

A13535-100ul 100 ul
EUR 308.00

PSMA4 Rabbit pAb

A13535-200ul 200 ul
EUR 459.00

PSMA4 Rabbit pAb

A13535-20ul 20 ul
EUR 183.00

PSMA4 Rabbit pAb

A13535-50ul 50 ul
EUR 223.00

PSMA4 Rabbit pAb

A2511-100ul 100 ul
EUR 308.00

PSMA4 Rabbit pAb

A2511-200ul 200 ul
EUR 459.00

PSMA4 Rabbit pAb

A2511-20ul 20 ul
EUR 183.00

PSMA4 Rabbit pAb

A2511-50ul 50 ul
EUR 223.00

anti- PSMA4 antibody

FNab06864 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) subunit, alpha type, 4
  • Uniprot ID: P25789
  • Gene ID: 5685
  • Research Area: Metabolism
Description: Antibody raised against PSMA4

Human PSMA4 Antibody

33351-05111 150 ug
EUR 261.00

Anti-PSMA4 antibody

STJ115496 100 µl
EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PSMA4 antibody

STJ25173 100 µl
EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PSMA4 antibody

STJ72341 100 µg
EUR 359.00

PSMA4 protein (His tag)

80R-2092 100 ug
EUR 322.00
Description: Recombinant human PSMA4 protein (His tag)

PSMA4 ELISA KIT|Human

EF002105 96 Tests
EUR 689.00

Mouse PSMA4 shRNA Plasmid

20-abx973721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMA4 shRNA Plasmid

20-abx985657
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMA4 shRNA Plasmid

20-abx953832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMA4 Antibody, HRP conjugated

1-CSB-PA018869LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA4. Recognizes PSMA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMA4 Antibody, FITC conjugated

1-CSB-PA018869LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA4. Recognizes PSMA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMA4 Antibody, Biotin conjugated

1-CSB-PA018869LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMA4. Recognizes PSMA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-PSMA4 (2A10-E4)

LF-MA10251 100 ug
EUR 363.00
Description: Mouse monoclonal to PSMA4

PSMA4 Recombinant Protein (Human)

RP024892 100 ug Ask for price

PSMA4 Recombinant Protein (Human)

RP024895 100 ug Ask for price

PSMA4 Recombinant Protein (Rat)

RP222590 100 ug Ask for price

PSMA4 Recombinant Protein (Mouse)

RP165245 100 ug Ask for price

PSMA4 ORF Vector (Human) (pORF)

ORF008298 1.0 ug DNA
EUR 95.00

PSMA4 ORF Vector (Human) (pORF)

ORF008299 1.0 ug DNA
EUR 95.00

Psma4 ORF Vector (Mouse) (pORF)

ORF055083 1.0 ug DNA
EUR 506.00

Psma4 ORF Vector (Rat) (pORF)

ORF074198 1.0 ug DNA
EUR 506.00

[One Step] PSMA4 Antibody Kit

RK05687 50 ul
EUR 240.00

Human PSMA4 Antibody (Biotin Conjugate)

33351-05121 150 ug
EUR 369.00

Polyclonal PSMA4 Antibody (internal region)

APG00695G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMA4 (internal region). This antibody is tested and proven to work in the following applications: