PSMB9

PSMB9 siRNA

20-abx904318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB9 siRNA

20-abx930158
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB9 siRNA

20-abx930159
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB9 antibody

10R-7115 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

10R-7116 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

10R-7117 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

10R-7119 100 ul
EUR 726.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

10R-7120 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

10R-7122 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB9 antibody

PSMB9 antibody

70R-5740 50 ug
EUR 467.00
Description: Rabbit polyclonal PSMB9 antibody raised against the C terminal of PSMB9

PSMB9 Antibody

ABD6606 100 ug
EUR 438.00

PSMB9 Antibody

32427-100ul 100ul
EUR 252.00

PSMB9 antibody

70R-19590 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMB9 antibody

PSMB9 Antibody

1-CSB-PA018887GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMB9. Recognizes PSMB9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMB9 Antibody

1-CSB-PA018887LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB9. Recognizes PSMB9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

PSMB9 Antibody

DF6606 200ul
EUR 304.00
Description: PSMB9 Antibody detects endogenous levels of total PSMB9.

PSMB9 Blocking Peptide

33R-8138 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB9 antibody, catalog no. 70R-5740

PSMB9 cloning plasmid

CSB-CL018887HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atgctgcgggcgggagcaccaaccggggacttaccccgggcgggagaagtccacaccgggaccaccatcatggcagtggagtttgacgggggcgttgtgatgggttctgattcccgagtgtctgcaggcgaggcggtggtgaaccgagtgtttgacaagctgtccccgctgcacga
  • Show more
Description: A cloning plasmid for the PSMB9 gene.

PSMB9 Conjugated Antibody

C32427 100ul
EUR 397.00

PSMB9 Rabbit pAb

A1771-100ul 100 ul
EUR 308.00

PSMB9 Rabbit pAb

A1771-200ul 200 ul
EUR 459.00

PSMB9 Rabbit pAb

A1771-20ul 20 ul
EUR 183.00

PSMB9 Rabbit pAb

A1771-50ul 50 ul
EUR 223.00

PSMB9 Blocking Peptide

DF6606-BP 1mg
EUR 195.00

Anti-PSMB9 antibody

STJ25179 100 µl
EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit.

Anti-PSMB9 antibody

STJ72371 100 µg
EUR 359.00

PSMB9 protein (His tag)

80R-1755 50 ug
EUR 305.00
Description: Purified recombinant Human PSMB9 protein

PSMB9 ELISA KIT|Human

EF006434 96 Tests
EUR 689.00

Human PSMB9 ELISA Kit

ELA-E1177h 96 Tests
EUR 824.00

Mouse PSMB9 shRNA Plasmid

20-abx971336
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMB9 shRNA Plasmid

20-abx984733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMB9 shRNA Plasmid

20-abx953845
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB9 Antibody, HRP conjugated

1-CSB-PA018887LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB9. Recognizes PSMB9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMB9 Antibody, FITC conjugated

1-CSB-PA018887LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB9. Recognizes PSMB9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMB9 Antibody, Biotin conjugated

1-CSB-PA018887LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB9. Recognizes PSMB9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMB9 Recombinant Protein (Human)

RP024946 100 ug Ask for price

pECMV- 3* FLAG- PSMB9

PVT11625 2 ug
EUR 304.00

PSMB9 Recombinant Protein (Rat)

RP222632 100 ug Ask for price

PSMB9 Recombinant Protein (Mouse)

RP165290 100 ug Ask for price

PSMB9 ORF Vector (Human) (pORF)

ORF008316 1.0 ug DNA
EUR 95.00

Psmb9 ORF Vector (Mouse) (pORF)

ORF055098 1.0 ug DNA
EUR 506.00

Anserini LMP7/PSMB9 ELISA Kit

EAL0251 96Tests
EUR 521.00

Psmb9 ORF Vector (Rat) (pORF)

ORF074212 1.0 ug DNA
EUR 506.00

Canine LMP7/PSMB9 ELISA Kit

ECL0251 96Tests
EUR 521.00

Bovine LMP7/PSMB9 ELISA Kit

EBL0251 96Tests
EUR 521.00

Rat LMP7/PSMB9 ELISA Kit

ERL0251 96Tests
EUR 521.00

Rabbit LMP7/PSMB9 ELISA Kit

ERTL0251 96Tests
EUR 521.00

Human LMP7/PSMB9 ELISA Kit

EHL0251 96Tests
EUR 521.00

Porcine LMP7/PSMB9 ELISA Kit

EPL0251 96Tests
EUR 521.00

Mouse LMP7/PSMB9 ELISA Kit

EML0251 96Tests
EUR 521.00

Goat LMP7/PSMB9 ELISA Kit

EGTL0251 96Tests
EUR 521.00

Polyclonal PSMB9 Antibody (C-Term)

APR04883G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB9 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB9 Antibody (C-term)

APR06094G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB9 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB9 Antibody (C-term)

APR06933G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB9 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB9 Antibody (internal region)

APG00705G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB9 (internal region). This antibody is tested and proven to work in the following applications: