PSMD1

PSMD1 siRNA

20-abx904326
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD1 siRNA

20-abx930184
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD1 siRNA

20-abx930185
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD1 antibody

70R-5630 50 ug
EUR 467
Description: Rabbit polyclonal PSMD1 antibody

PSMD1 antibody

70R-5638 50 ug
EUR 467
Description: Rabbit polyclonal PSMD1 antibody

anti-PSMD1

YF-PA24506 50 ul
EUR 334
Description: Mouse polyclonal to PSMD1

PSMD1 Rabbit pAb

A16420-100ul 100 ul
EUR 308

PSMD1 Rabbit pAb

A16420-200ul 200 ul
EUR 459

PSMD1 Rabbit pAb

A16420-20ul 20 ul
EUR 183

PSMD1 Rabbit pAb

A16420-50ul 50 ul
EUR 223

PSMD1 Blocking Peptide

33R-3879 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMD1 antibody, catalog no. 70R-5630

PSMD1 Blocking Peptide

33R-2074 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMD1 antibody, catalog no. 70R-5638

PSMD1 Polyclonal Antibody

29836-100ul 100ul
EUR 252

PSMD1 Polyclonal Antibody

29836-50ul 50ul
EUR 187

PSMD1 cloning plasmid

CSB-CL860765HU-10ug 10ug
EUR 910
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2862
  • Sequence: ATGATCACCTCGGCCGCTGGAATTATTTCTCTTCTGGATGAAGATGAACCACAGCTTAAGGAATTTGCACTACACAAATTGAATGCAGTTGTTAATGACTTCTGGGCAGAAATTTCCGAGTCCGTAGACAAAATAGAGGTTTTATACGAAGATGAAGGTTTCCGGAGTCGGCAGT
  • Show more
Description: A cloning plasmid for the PSMD1 gene.

Anti-PSMD1 antibody

STJ118860 100 µl
EUR 277

PSMD1 Polyclonal Conjugated Antibody

C29836 100ul
EUR 397

Mouse PSMD1 shRNA Plasmid

20-abx977158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMD1 shRNA Plasmid

20-abx986864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken PSMD1 ELISA KIT

ELI-12803c 96 Tests
EUR 928

Human PSMD1 ELISA KIT

ELI-19795h 96 Tests
EUR 824

Mouse Psmd1 ELISA KIT

ELI-15656m 96 Tests
EUR 865

Human PSMD1 shRNA Plasmid

20-abx953853
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Psmd1 ORF Vector (Rat) (pORF)

ORF074220 1.0 ug DNA
EUR 506

PSMD1 ORF Vector (Human) (pORF)

ORF014190 1.0 ug DNA
EUR 354

Psmd1 ORF Vector (Mouse) (pORF)

ORF055106 1.0 ug DNA
EUR 506

pECMV-Psmd1-m-FLAG Plasmid

PVT14870 2 ug
EUR 325

PSMD1 sgRNA CRISPR Lentivector set (Human)

K1741901 3 x 1.0 ug
EUR 339

Psmd1 sgRNA CRISPR Lentivector set (Mouse)

K4786801 3 x 1.0 ug
EUR 339

Psmd1 sgRNA CRISPR Lentivector set (Rat)

K7118501 3 x 1.0 ug
EUR 339

PSMD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1741902 1.0 ug DNA
EUR 154

PSMD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1741903 1.0 ug DNA
EUR 154

PSMD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1741904 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4786802 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4786803 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4786804 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7118502 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7118503 1.0 ug DNA
EUR 154

Psmd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7118504 1.0 ug DNA
EUR 154

PSMD1 Protein Vector (Human) (pPB-C-His)

PV056757 500 ng
EUR 481

PSMD1 Protein Vector (Human) (pPB-N-His)

PV056758 500 ng
EUR 481

PSMD1 Protein Vector (Human) (pPM-C-HA)

PV056759 500 ng
EUR 481

PSMD1 Protein Vector (Human) (pPM-C-His)

PV056760 500 ng
EUR 481

PSMD1 Protein Vector (Rat) (pPB-C-His)

PV296878 500 ng
EUR 1166

PSMD1 Protein Vector (Rat) (pPB-N-His)

PV296879 500 ng
EUR 1166

PSMD1 Protein Vector (Rat) (pPM-C-HA)

PV296880 500 ng
EUR 1166

PSMD1 Protein Vector (Rat) (pPM-C-His)

PV296881 500 ng
EUR 1166

PSMD1 Protein Vector (Mouse) (pPB-C-His)

PV220422 500 ng
EUR 1065

PSMD1 Protein Vector (Mouse) (pPB-N-His)

PV220423 500 ng
EUR 1065

PSMD1 Protein Vector (Mouse) (pPM-C-HA)

PV220424 500 ng
EUR 1065

PSMD1 Protein Vector (Mouse) (pPM-C-His)

PV220425 500 ng
EUR 1065

Psmd1 3'UTR GFP Stable Cell Line

TU167182 1.0 ml Ask for price

PSMD1 3'UTR Luciferase Stable Cell Line

TU019062 1.0 ml
EUR 1521

Psmd1 3'UTR Luciferase Stable Cell Line

TU117182 1.0 ml Ask for price

PSMD1 3'UTR GFP Stable Cell Line

TU069062 1.0 ml
EUR 1521