PSMD5

PSMD5 siRNA

20-abx930193
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD5 protein

80R-4301 100 ug
EUR 327.00
Description: Purified Recombinant PSMD5 protein (His tagged)

PSMD5 Antibody

1-CSB-PA618074ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD5. Recognizes PSMD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSMD5 Antibody

35896-100ul 100ul
EUR 252.00

PSMD5 antibody

70R-19604 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMD5 antibody

PSMD5 Antibody

1-CSB-PA228317
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD5. Recognizes PSMD5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PSMD5 Antibody

1-CSB-PA221695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD5. Recognizes PSMD5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PSMD5 Antibody

1-CSB-PA018910GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD5. Recognizes PSMD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMD5 cloning plasmid

CSB-CL618074HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atggcagcccaggctttggcgctgctgagagaggtagcgaggctggaagcgccgctggaggagctacgcgcgcttcactccgtgctgcaggcagtgccgctcaacgagcttcgccagcaagcggcggagctgcgcctcggcccgctcttctccctgcttaacgagaaccataggg
  • Show more
Description: A cloning plasmid for the PSMD5 gene.

PSMD5 Conjugated Antibody

C35896 100ul
EUR 397.00

anti-PSMD5 (3E2)

LF-MA10258 100 ug
EUR 363.00
Description: Mouse monoclonal to PSMD5

Anti-PSMD5 antibody

PAab06891 100 ug
EUR 355.00

PSMD5 Rabbit pAb

A6954-100ul 100 ul
EUR 308.00

PSMD5 Rabbit pAb

A6954-200ul 200 ul
EUR 459.00

PSMD5 Rabbit pAb

A6954-20ul 20 ul
EUR 183.00

PSMD5 Rabbit pAb

A6954-50ul 50 ul
EUR 223.00

PSMD5 Rabbit pAb

A4056-100ul 100 ul
EUR 308.00

PSMD5 Rabbit pAb

A4056-200ul 200 ul
EUR 459.00

PSMD5 Rabbit pAb

A4056-20ul 20 ul Ask for price

PSMD5 Rabbit pAb

A4056-50ul 50 ul Ask for price

anti- PSMD5 antibody

FNab06891 100µg
EUR 505.25
  • Immunogen: proteasome(prosome, macropain) 26S subunit, non-ATPase, 5
  • Uniprot ID: Q16401
  • Gene ID: 5711
  • Research Area: Metabolism
Description: Antibody raised against PSMD5

Anti-PSMD5 antibody

STJ29034 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly.

Anti-PSMD5 antibody

STJ25190 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly.

Mouse Psmd5 ELISA KIT

ELI-37878m 96 Tests
EUR 865.00

Bovine PSMD5 ELISA KIT

ELI-35896b 96 Tests
EUR 928.00

Human PSMD5 ELISA KIT

ELI-35897h 96 Tests
EUR 824.00

PSMD5 ELISA KIT|Human

EF002134 96 Tests
EUR 689.00

Mouse PSMD5 shRNA Plasmid

20-abx975910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMD5 shRNA Plasmid

20-abx953857
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD5 Recombinant Protein (Human)

RP025006 100 ug Ask for price

PSMD5 Recombinant Protein (Rat)

RP222683 100 ug Ask for price

PSMD5 Recombinant Protein (Mouse)

RP165344 100 ug Ask for price

PSMD5 ORF Vector (Human) (pORF)

ORF008336 1.0 ug DNA
EUR 95.00

Psmd5 ORF Vector (Mouse) (pORF)

ORF055116 1.0 ug DNA
EUR 506.00

Psmd5 ORF Vector (Rat) (pORF)

ORF074229 1.0 ug DNA
EUR 506.00

Polyclonal PSMD5 Antibody(C-term)

APR04461G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD5 (C-term). This antibody is tested and proven to work in the following applications:

Psmd5 sgRNA CRISPR Lentivector set (Mouse)

K4059601 3 x 1.0 ug
EUR 339.00

Psmd5 sgRNA CRISPR Lentivector set (Rat)

K6148501 3 x 1.0 ug
EUR 339.00

PSMD5 sgRNA CRISPR Lentivector set (Human)

K1742401 3 x 1.0 ug
EUR 339.00

Psmd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4059602 1.0 ug DNA
EUR 154.00

Psmd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4059603 1.0 ug DNA
EUR 154.00

Psmd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4059604 1.0 ug DNA
EUR 154.00

PSMD5 Protein Vector (Rat) (pPB-C-His)

PV296914 500 ng
EUR 603.00

PSMD5 Protein Vector (Rat) (pPB-N-His)

PV296915 500 ng
EUR 603.00

PSMD5 Protein Vector (Rat) (pPM-C-HA)

PV296916 500 ng
EUR 603.00

PSMD5 Protein Vector (Rat) (pPM-C-His)

PV296917 500 ng
EUR 603.00

PSMD5 Protein Vector (Human) (pPB-C-His)

PV033341 500 ng
EUR 329.00

PSMD5 Protein Vector (Human) (pPB-N-His)

PV033342 500 ng
EUR 329.00

PSMD5 Protein Vector (Human) (pPM-C-HA)

PV033343 500 ng
EUR 329.00

PSMD5 Protein Vector (Human) (pPM-C-His)

PV033344 500 ng
EUR 329.00

PSMD5 Protein Vector (Mouse) (pPB-C-His)

PV220462 500 ng
EUR 603.00

PSMD5 Protein Vector (Mouse) (pPB-N-His)

PV220463 500 ng
EUR 603.00

PSMD5 Protein Vector (Mouse) (pPM-C-HA)

PV220464 500 ng
EUR 603.00

PSMD5 Protein Vector (Mouse) (pPM-C-His)

PV220465 500 ng
EUR 603.00

PSMD5 3'UTR Luciferase Stable Cell Line

TU019067 1.0 ml
EUR 2333.00