PSME1 antibody

70R-19607 50 ul
EUR 435.00
Description: Rabbit polyclonal PSME1 antibody

PSME1 Antibody

32798-100ul 100ul
EUR 252.00

PSME1 antibody

10R-11437 50 ul
EUR 241.00
Description: Mouse Monoclonal PSME1 antibody

PSME1 Antibody

49782-100ul 100ul
EUR 333.00

PSME1 Antibody

49782-50ul 50ul
EUR 239.00

PSME1 Antibody

DF7298 200ul
EUR 304.00
Description: PSME1 Antibody detects endogenous levels of total PSME1.

PSME1 antibody

70R-5746 50 ug
EUR 467.00
Description: Rabbit polyclonal PSME1 antibody raised against the middle region of PSME1

PSME1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IP:1:200-1:2000

PSME1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSME1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSME1 Antibody

ABD7298 100 ug
EUR 438.00


YF-PA14149 50 ug
EUR 363.00
Description: Mouse polyclonal to PSME1


YF-PA14150 50 ul
EUR 363.00
Description: Mouse polyclonal to PSME1


YF-PA14151 50 ug
EUR 363.00
Description: Mouse polyclonal to PSME1


YF-PA14152 100 ug
EUR 403.00
Description: Rabbit polyclonal to PSME1

PSME1 Monoclonal Antibody

EUR 300.00

PSME1 Blocking Peptide

33R-4340 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSME1 antibody, catalog no. 70R-5746

PSME1 Blocking Peptide

DF7298-BP 1mg
EUR 195.00

PSME1 Conjugated Antibody

C49782 100ul
EUR 397.00

PSME1 Conjugated Antibody

C32798 100ul
EUR 397.00

PSME1 cloning plasmid

CSB-CL018915HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcatttttaaaggagccagctctcaatgaagccaacttgagcaatctgaaggc
  • Show more
Description: A cloning plasmid for the PSME1 gene.

PSME1 Rabbit pAb

A5358-100ul 100 ul
EUR 308.00

PSME1 Rabbit pAb

A5358-200ul 200 ul
EUR 459.00

PSME1 Rabbit pAb

A5358-20ul 20 ul
EUR 183.00

PSME1 Rabbit pAb

A5358-50ul 50 ul
EUR 223.00

anti- PSME1 antibody

FNab06894 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
  • Uniprot ID: Q06323
  • Gene ID: 5720
  • Research Area: Metabolism
Description: Antibody raised against PSME1

Anti-PSME1 antibody

PAab06894 100 ug
EUR 355.00

Anti-PSME1 antibody

STJ27311 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants.

PSME1 protein (His tag)

80R-1511 50 ug
EUR 305.00
Description: Purified recombinant Human PSME1 protein


EF002137 96 Tests
EUR 689.00

Mouse PSME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSME1 (Isoform 1) Antibody

abx431528-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Human PSME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSME1 Recombinant Protein (Human)

RP025021 100 ug Ask for price

PSME1 Recombinant Protein (Mouse)

RP165359 100 ug Ask for price

PSME1 Recombinant Protein (Rat)

RP222698 100 ug Ask for price

Polyclonal PSME1 Antibody (C-term)

APR05603G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSME1 (C-term). This antibody is tested and proven to work in the following applications:

Psme1 ORF Vector (Rat) (pORF)

ORF074234 1.0 ug DNA
EUR 506.00

PSME1 ORF Vector (Human) (pORF)

ORF008341 1.0 ug DNA
EUR 95.00

Psme1 ORF Vector (Mouse) (pORF)

ORF055121 1.0 ug DNA
EUR 506.00

Anti-PSME1 (isoform 1) antibody

STJ71163 100 µg
EUR 359.00

PSME1 ELISA Kit (Human) (OKCA00768)

OKCA00768 96 Wells
EUR 833.00
Description: Description of target: Implicated in immunoproteasome assembly and required for efficient antigen processing. The PA28 activator complex enhances the generation of class I binding peptides by altering the cleavage pattern of the proteasome. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.75 pg/mL

Proteasome Activator Subunit 1 (PSME1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

abx032458-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

abx032458-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

abx236894-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Psme1 sgRNA CRISPR Lentivector set (Rat)

K6849001 3 x 1.0 ug
EUR 339.00

Psme1 sgRNA CRISPR Lentivector set (Mouse)

K4004901 3 x 1.0 ug
EUR 339.00

PSME1 sgRNA CRISPR Lentivector set (Human)

K1744101 3 x 1.0 ug
EUR 339.00

Human Proteasome activator complex subunit 1 (PSME1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 55.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proteasome activator complex subunit 1(PSME1) expressed in E.coli