PSME1 siRNA
20-abx930202	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSME1 siRNA
20-abx930203	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSME1 antibody
70R-5746	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PSME1 antibody raised against the middle region of PSME1

PSME1 Antibody
ABD7298	Lifescience Market	100 ug	EUR 438

PSME1 Antibody
49782-100ul	SAB	100ul	EUR 333

PSME1 Antibody
49782-50ul	SAB	50ul	EUR 239

PSME1 antibody
10R-11437	Fitzgerald	50 ul	EUR 241
Description: Mouse Monoclonal PSME1 antibody

PSME1 Antibody
32798-100ul	SAB	100ul	EUR 252

PSME1 antibody
70R-19607	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PSME1 antibody

PSME1 Antibody
DF7298	Affbiotech	200ul	EUR 304
Description: PSME1 Antibody detects endogenous levels of total PSME1.

PSME1 Antibody
1-CSB-PA018915DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IP:1:200-1:2000

PSME1 Antibody
1-CSB-PA018915DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSME1 Antibody
1-CSB-PA018915GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSME1. Recognizes PSME1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-PSME1
YF-PA14149	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PSME1

anti-PSME1
YF-PA14150	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PSME1

anti-PSME1
YF-PA14151	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PSME1

anti-PSME1
YF-PA14152	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PSME1

PSME1 Conjugated Antibody
C49782	SAB	100ul	EUR 397

PSME1 Conjugated Antibody
C32798	SAB	100ul	EUR 397

PSME1 cloning plasmid
CSB-CL018915HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 750 Sequence: atggccatgctcagggtccagcccgaggcccaagccaaggtggatgtgtttcgtgaagacctctgtaccaagacagagaacctgctcgggagctatttccccaagaagatttctgagctggatgcatttttaaaggagccagctctcaatgaagccaacttgagcaatctgaaggc Show more
Description: A cloning plasmid for the PSME1 gene.

anti- PSME1 antibody
FNab06894	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Uniprot ID: Q06323 Gene ID: 5720 Research Area: Metabolism
Description: Antibody raised against PSME1

PSME1 Monoclonal Antibody
A1061-50	Biovision		EUR 300

PSME1 Rabbit pAb
A5358-100ul	Abclonal	100 ul	EUR 308

PSME1 Rabbit pAb
A5358-200ul	Abclonal	200 ul	EUR 459

PSME1 Rabbit pAb
A5358-20ul	Abclonal	20 ul	EUR 183

PSME1 Rabbit pAb
A5358-50ul	Abclonal	50 ul	EUR 223

PSME1 Blocking Peptide
33R-4340	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSME1 antibody, catalog no. 70R-5746

PSME1 Blocking Peptide
DF7298-BP	Affbiotech	1mg	EUR 195

Anti-PSME1 antibody
PAab06894	Lifescience Market	100 ug	EUR 355

Anti-PSME1 antibody
STJ27311	St John's Laboratory	100 µl	EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants.

PSME1 ELISA KIT|Human
EF002137	Lifescience Market	96 Tests	EUR 689

PSME1 (Isoform 1) Antibody
abx431528-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Human PSME1 shRNA Plasmid
20-abx953865	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSME1 protein (His tag)
80R-1511	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human PSME1 protein

Mouse PSME1 shRNA Plasmid
20-abx972250	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSME1 Recombinant Protein (Human)
RP025021	ABM	100 ug	Ask for price

PSME1 Recombinant Protein (Rat)
RP222698	ABM	100 ug	Ask for price

PSME1 Recombinant Protein (Mouse)
RP165359	ABM	100 ug	Ask for price

Polyclonal PSME1 Antibody (C-term)
APR05603G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSME1 (C-term). This antibody is tested and proven to work in the following applications:

PSME1 ORF Vector (Human) (pORF)
ORF008341	ABM	1.0 ug DNA	EUR 95

Psme1 ORF Vector (Rat) (pORF)
ORF074234	ABM	1.0 ug DNA	EUR 506

Psme1 ORF Vector (Mouse) (pORF)
ORF055121	ABM	1.0 ug DNA	EUR 506

Anti-PSME1 (isoform 1) antibody
STJ71163	St John's Laboratory	100 µg	EUR 359

PSME1 ELISA Kit (Human) (OKCA00768)
OKCA00768	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Implicated in immunoproteasome assembly and required for efficient antigen processing. The PA28 activator complex enhances the generation of class I binding peptides by altering the cleavage pattern of the proteasome. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.75 pg/mL

Proteasome Activator Subunit 1 (PSME1) Antibody
20-abx114755	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
abx032458-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
abx032458-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
20-abx004099	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
20-abx322358	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
20-abx322359	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Proteasome Activator Subunit 1 (PSME1) Antibody
abx236894-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

PSME1 sgRNA CRISPR Lentivector set (Human)
K1744101	ABM	3 x 1.0 ug	EUR 339

Psme1 sgRNA CRISPR Lentivector set (Mouse)
K4004901	ABM	3 x 1.0 ug	EUR 339

Psme1 sgRNA CRISPR Lentivector set (Rat)
K6849001	ABM	3 x 1.0 ug	EUR 339

Polyclonal Goat Anti-PSME1 (isoform 1) Antibody
APG00254G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PSME1 (isoform 1) . This antibody is tested and proven to work in the following applications: