RAB2A

RAB2A Antibody

1-CSB-PA019180GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB2A Antibody

1-CSB-PA019180LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human. This antibody is Unconjugated. Tested in the following application: ELISA

RAB2A Antibody

36712-100ul 100ul
EUR 252.00

RAB2A Antibody

ABD4399 100 ug
EUR 438.00

RAB2A antibody

70R-10318 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB2A antibody

RAB2A antibody

70R-10319 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB2A antibody

RAB2A antibody

70R-12993 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal RAB2A antibody

RAB2A antibody

70R-19698 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB2A antibody

RAB2A siRNA

20-abx930634
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB2A siRNA

20-abx930635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB2A siRNA

20-abx904421
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB2A Antibody

1-CSB-PA040134
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RAB2A Antibody

1-CSB-PA162500
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:20-1:100

RAB2A Antibody

1-CSB-PA226407
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB2A Antibody

1-CSB-PA287240
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150

RAB2A Antibody

1-CSB-PA969438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RAB2A Antibody

DF4399 200ul
EUR 304.00
Description: RAB2A Antibody detects endogenous levels of total RAB2A.

Rab2A, Member Ras Oncogene Family (RAB2A) Antibody

20-abx114976
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx126447
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx241837
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx241838
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx242033
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx328663
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Small GTP Binding Protein RAB2A (RAB2A) Antibody

abx159673-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

RAB2A, Member RAS Oncogene Family (RAB2A) Antibody

20-abx213993
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB2A Conjugated Antibody

C36712 100ul
EUR 397.00

RAB2A Polyclonal Antibody

A55998 100 µg
EUR 570.55
Description: fast delivery possible

RAB2A cloning plasmid

CSB-CL019180HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 639
  • Sequence: atggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgttggtaaatcatgcttattgctacagtttacagacaagaggtttcagccagtgcatgaccttactattggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagat
  • Show more
Description: A cloning plasmid for the RAB2A gene.

RAB2A Blocking Peptide

33R-3450 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB2A antibody, catalog no. 70R-10318

RAB2A Blocking Peptide

33R-6894 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB2A antibody, catalog no. 70R-10319

RAB2A Polyclonal Antibody

E-AB-11513-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight g
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for IHC,ELISA applications.

RAB2A Polyclonal Antibody

E-AB-11513-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight g
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for IHC,ELISA applications.

RAB2A Polyclonal Antibody

E-AB-11513-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight g
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for IHC,ELISA applications.

RAB2A Polyclonal Antibody

E-AB-32698-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Required for protein transport from the endoplasmic reticulum to the Golgi complex.
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for WB,IHC-p,ELISA applications.

RAB2A Polyclonal Antibody

E-AB-32698-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Required for protein transport from the endoplasmic reticulum to the Golgi complex.
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for WB,IHC-p,ELISA applications.

RAB2A Polyclonal Antibody

E-AB-32698-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Required for protein transport from the endoplasmic reticulum to the Golgi complex.
Description: Rabbit antibody against Human,Mouse,Rat RAB2A for WB,IHC-p,ELISA applications.

RAB2A Rabbit pAb

A11634-100ul 100 ul
EUR 308.00

RAB2A Rabbit pAb

A11634-200ul 200 ul
EUR 459.00

RAB2A Rabbit pAb

A11634-20ul 20 ul
EUR 183.00

RAB2A Rabbit pAb

A11634-50ul 50 ul
EUR 223.00

RAB2A Blocking Peptide

DF4399-BP 1mg
EUR 195.00

Anti-RAB2A antibody

STJ113239 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RAB2A antibody

STJ11100858 100 µl
EUR 413.00
Description: The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

RAB2A Antibody, HRP conjugated

1-CSB-PA019180LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB2A Antibody, FITC conjugated

1-CSB-PA019180LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB2A Antibody, Biotin conjugated

1-CSB-PA019180LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB2A. Recognizes RAB2A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RAB2A shRNA Plasmid

20-abx975148
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB2A shRNA Plasmid

20-abx986406
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB2A protein (His tag)

80R-1857 100 ug
EUR 457.00
Description: Purified recombinant RAB2A protein

Human RAB2A shRNA Plasmid

20-abx953952
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine RAB2A ELISA KIT

ELI-36099d 96 Tests
EUR 928.00

Anti-Rab2/RAB2A Antibody

PA2306 100ug/vial
EUR 294.00

RAB2A Recombinant Protein (Rat)

RP223298 100 ug Ask for price

RAB2A Recombinant Protein (Human)

RP025459 100 ug Ask for price

RAB2A Recombinant Protein (Mouse)

RP166253 100 ug Ask for price

Anti-RAB2 / RAB2A antibody

STJ70010 100 µg
EUR 359.00

Rab2A(C-term) Monoclonal Antibody

27064-100ul 100ul
EUR 252.00

Rab2A(C-term) Monoclonal Antibody

27064-50ul 50ul
EUR 187.00

RAB2A Polyclonal Antibody, HRP Conjugated

A55999 100 µg
EUR 570.55
Description: reagents widely cited

RAB2A Polyclonal Antibody, FITC Conjugated

A56000 100 µg
EUR 570.55
Description: Ask the seller for details

RAB2A Polyclonal Antibody, Biotin Conjugated

A56001 100 µg
EUR 570.55
Description: The best epigenetics products

Rab2a ORF Vector (Rat) (pORF)

ORF074434 1.0 ug DNA
EUR 506.00

RAB2A ORF Vector (Human) (pORF)

ORF008487 1.0 ug DNA
EUR 95.00

Rab2a ORF Vector (Mouse) (pORF)

ORF055419 1.0 ug DNA
EUR 506.00

[KO Validated] RAB2A Rabbit pAb

A19982-100ul 100 ul
EUR 410.00

[KO Validated] RAB2A Rabbit pAb

A19982-200ul 200 ul
EUR 571.00

[KO Validated] RAB2A Rabbit pAb

A19982-20ul 20 ul
EUR 221.00

[KO Validated] RAB2A Rabbit pAb

A19982-50ul 50 ul
EUR 287.00

RAB2A sgRNA CRISPR Lentivector set (Human)

K1768201 3 x 1.0 ug
EUR 339.00

Rab2a sgRNA CRISPR Lentivector set (Mouse)

K4891801 3 x 1.0 ug
EUR 339.00

RAB2A, Member RAS Oncogene Family Protein

20-abx261972
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rab2A(C-term) Conjugated Monoclonal Antibody

C27064 100ul
EUR 397.00

Rab2a sgRNA CRISPR Lentivector set (Rat)

K7109701 3 x 1.0 ug
EUR 339.00

Polyclonal Goat Anti-RAB2 / RAB2A Antibody

APG00261G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAB2 / RAB2A . This antibody is tested and proven to work in the following applications:

Polyclonal RAB2A antibody - C-terminal region

APR01480G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB2A - C-terminal region. This antibody is tested and proven to work in the following applications:

Ras-Related Protein Rab-2A (RAB2A) Antibody

20-abx109364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB2A sgRNA CRISPR Lentivector (Human) (Target 1)

K1768202 1.0 ug DNA
EUR 154.00

RAB2A sgRNA CRISPR Lentivector (Human) (Target 2)

K1768203 1.0 ug DNA
EUR 154.00

RAB2A sgRNA CRISPR Lentivector (Human) (Target 3)

K1768204 1.0 ug DNA
EUR 154.00

Rab2a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4891802 1.0 ug DNA
EUR 154.00

Rab2a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4891803 1.0 ug DNA
EUR 154.00

Rab2a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4891804 1.0 ug DNA
EUR 154.00

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05977 5µg Ask for price

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05978 20µg Ask for price

Recombinant Human RAB2A, Member RAS Oncogene Family

7-05979 1mg Ask for price