RAB34

RAB34 Antibody

1-CSB-PA003895
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB34. Recognizes RAB34 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

RAB34 Antibody

1-CSB-PA019187GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB34. Recognizes RAB34 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB34 Antibody

34969-100ul 100ul
EUR 252.00

RAB34 Antibody

34969-50ul 50ul
EUR 187.00

RAB34 antibody

70R-10114 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB34 antibody

RAB34 antibody

70R-19703 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB34 antibody

RAB34 siRNA

20-abx930648
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB34 siRNA

20-abx930649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB34 siRNA

20-abx900017
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB34 siRNA

20-abx900038
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB34 Antibody

CSB-PA087223-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB34. Recognizes RAB34 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RAB34 Antibody

CSB-PA087223-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB34. Recognizes RAB34 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RAB34, Member RAS Oncogene Family (RAB34) Antibody

20-abx133603
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rab34, Member Ras Oncogene Family (RAB34) Antibody

20-abx114982
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

20-abx126448
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

20-abx324742
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

abx145582-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

abx237018-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

20-abx014796
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

RAB34, Member RAS Oncogene Family (RAB34) Antibody

abx330370-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

RAB34 Conjugated Antibody

C34969 100ul
EUR 397.00

RAB34 Blocking Peptide

20-abx061185
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB34 cloning plasmid

CSB-CL319769HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 756
  • Sequence: atgaacattctggcacccgtgcggagggatcgcgtcctggcggagctgccccagtgcctgaggaaggaggccgctttgcacgggcacaaagacttccacccccgcgtcacctgcgcctgccaggagcaccggacaggcaccgtgggatttaagatctccaaggtcattgtggtggg
  • Show more
Description: A cloning plasmid for the RAB34 gene.

RAB34 cloning plasmid

CSB-CL319769HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atgaacattctggcacccgtgcggagggatcgcgtcctggcggagctgccccagtgcctgaggaaggaggccgctttgcacgggcacaaagacttccacccccgcgtcacctgcgcctgccaggagcaccggacaggcaccgtgggatttaagatctccaaggtcattgtggtggg
  • Show more
Description: A cloning plasmid for the RAB34 gene.

RAB34 Blocking Peptide

33R-2887 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB34 antibody, catalog no. 70R-10114

RAB34 Polyclonal Antibody

E-AB-32702-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Protein transport. Involved in the redistribution of lysosomes to the peri-Golgi region.
Description: Rabbit antibody against Human RAB34 for WB,IHC-p,ELISA applications.

RAB34 Polyclonal Antibody

E-AB-32702-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Protein transport. Involved in the redistribution of lysosomes to the peri-Golgi region.
Description: Rabbit antibody against Human RAB34 for WB,IHC-p,ELISA applications.

RAB34 Polyclonal Antibody

E-AB-32702-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: Protein transport. Involved in the redistribution of lysosomes to the peri-Golgi region.
Description: Rabbit antibody against Human RAB34 for WB,IHC-p,ELISA applications.

Anti-RAB34 antibody

PAab07018 100 ug
EUR 355.00

pCMV-SPORT6-RAB34

PVT13938 2 ug
EUR 391.00

anti- RAB34 antibody

FNab07018 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:200-1:2000
  • IHC: 1:50-1:500
  • Immunogen: RAB34, member RAS oncogene family
  • Uniprot ID: Q9BZG1
  • Gene ID: 83871
  • Research Area: Signal Transduction
Description: Antibody raised against RAB34

Polyclonal RAB34 Antibody

AMM07468G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB34 . This antibody is tested and proven to work in the following applications:

Anti-Rab34 (3A5)

YF-MA19490 100 ug
EUR 363.00
Description: Mouse monoclonal to Rab34

RAB34 Rabbit pAb

A10332-100ul 100 ul
EUR 308.00

RAB34 Rabbit pAb

A10332-200ul 200 ul
EUR 459.00

RAB34 Rabbit pAb

A10332-20ul 20 ul
EUR 183.00

RAB34 Rabbit pAb

A10332-50ul 50 ul
EUR 223.00

Anti-RAB34 antibody

STJ112370 100 µl
EUR 277.00
Description: This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame.

Human RAB34 shRNA Plasmid

20-abx968952
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB34 shRNA Plasmid

20-abx990059
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB34 shRNA Plasmid

20-abx972375
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB34 protein (His tag)

80R-2033 50 ug
EUR 424.00
Description: Recombinant human RAB34 protein (His tag)

Human RAB34 shRNA Plasmid

20-abx963211
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB34 ELISA KIT|Human

EF002234 96 Tests
EUR 689.00

Human RAB34 ELISA KIT

ELI-36972h 96 Tests
EUR 824.00

RAB34 Recombinant Protein (Rat)

RP223319 100 ug Ask for price

RAB34 Recombinant Protein (Human)

RP025480 100 ug Ask for price

RAB34 Recombinant Protein (Human)

RP025483 100 ug Ask for price

RAB34 Recombinant Protein (Mouse)

RP166274 100 ug Ask for price

RAB34 Recombinant Protein (Mouse)

RP166277 100 ug Ask for price

Rab34 ORF Vector (Rat) (pORF)

ORF074441 1.0 ug DNA
EUR 506.00

RAB34 ORF Vector (Human) (pORF)

ORF008494 1.0 ug DNA
EUR 95.00

RAB34 ORF Vector (Human) (pORF)

ORF008495 1.0 ug DNA
EUR 95.00

Rab34 ORF Vector (Mouse) (pORF)

ORF055426 1.0 ug DNA
EUR 506.00

Rab34 ORF Vector (Mouse) (pORF)

ORF055427 1.0 ug DNA
EUR 506.00

RAB34 sgRNA CRISPR Lentivector set (Human)

K1773701 3 x 1.0 ug
EUR 339.00

Rab34 sgRNA CRISPR Lentivector set (Mouse)

K3418701 3 x 1.0 ug
EUR 339.00

RAB34, Member RAS Oncogene Family Protein

20-abx262932
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rab34 sgRNA CRISPR Lentivector set (Rat)

K6542301 3 x 1.0 ug
EUR 339.00

RAB34 sgRNA CRISPR Lentivector (Human) (Target 1)

K1773702 1.0 ug DNA
EUR 154.00

RAB34 sgRNA CRISPR Lentivector (Human) (Target 2)

K1773703 1.0 ug DNA
EUR 154.00

RAB34 sgRNA CRISPR Lentivector (Human) (Target 3)

K1773704 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3418702 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3418703 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3418704 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6542302 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6542303 1.0 ug DNA
EUR 154.00

Rab34 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6542304 1.0 ug DNA
EUR 154.00

RAB34 Protein Vector (Human) (pPB-C-His)

PV033973 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPB-N-His)

PV033974 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPM-C-HA)

PV033975 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPM-C-His)

PV033976 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPB-C-His)

PV033977 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPB-N-His)

PV033978 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPM-C-HA)

PV033979 500 ng
EUR 329.00

RAB34 Protein Vector (Human) (pPM-C-His)

PV033980 500 ng
EUR 329.00

RAB34 3'UTR Luciferase Stable Cell Line

TU019388 1.0 ml
EUR 1394.00

Rab34 3'UTR GFP Stable Cell Line

TU167414 1.0 ml Ask for price

RAB34 Protein Vector (Mouse) (pPB-C-His)

PV221702 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPB-N-His)

PV221703 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPM-C-HA)

PV221704 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPM-C-His)

PV221705 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPB-C-His)

PV221706 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPB-N-His)

PV221707 500 ng
EUR 603.00

RAB34 Protein Vector (Mouse) (pPM-C-HA)

PV221708 500 ng
EUR 603.00