RAB39B

RAB39B siRNA

20-abx930661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB39B Antibody

37762-100ul 100ul
EUR 252.00

RAB39B antibody

70R-5833 50 ug
EUR 467.00
Description: Rabbit polyclonal RAB39B antibody raised against the N terminal of RAB39B

RAB39B Antibody

ABD9829 100 ug
EUR 438.00

RAB39B Antibody

1-CSB-PA822194LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAB39B antibody

70R-19707 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB39B antibody

RAB39B Antibody

1-CSB-PA112057
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

RAB39B Antibody

1-CSB-PA150668
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200

RAB39B Antibody

1-CSB-PA019193GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

pENTR223- RAB39B

PVT10082 2 ug
EUR 266.00

anti-RAB39B

YF-PA21979 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB39B

anti-RAB39B

YF-PA21980 100 ul
EUR 403.00
Description: Rabbit polyclonal to RAB39B

anti-RAB39B

YF-PA21981 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB39B

RAB39B Antibody

DF9829 200ul
EUR 304.00
Description: RAB39B Antibody detects endogenous levels of total RAB39B.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

abx218126-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

20-abx213031
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

20-abx213100
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

abx237023-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

abx029788-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

abx029788-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

20-abx302019
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rab39B, Member Ras Oncogene Family (RAB39B) Antibody

20-abx114986
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody

20-abx121204
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody (HRP)

20-abx308880
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody (FITC)

20-abx308881
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB39B, Member RAS Oncogene Family (RAB39B) Antibody (Biotin)

20-abx308882
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB39B Polyclonal Antibody

A66282 100 µg
EUR 570.55
Description: fast delivery possible

RAB39B cloning plasmid

CSB-CL822194HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atggaggccatctggctgtaccagttccggctcattgtcatcggggattccacagtgggcaagtcctgcctgatccgccgcttcaccgagggtcgctttgcccaggtttctgaccccaccgtgggggtggattttttctcccgcttggtggagatcgagccaggaaaacgcatcaa
  • Show more
Description: A cloning plasmid for the RAB39B gene.

RAB39B Blocking Peptide

33R-5891 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB39B antibody, catalog no. 70R-5833

RAB39B Blocking Peptide

20-abx161204
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB39B Conjugated Antibody

C37762 100ul
EUR 397.00

Anti-RAB39B (1E11)

YF-MA19768 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB39B

Anti-RAB39B (3B7)

YF-MA20606 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB39B

Anti-RAB39B antibody

PAab07023 100 ug
EUR 386.00

RAB39B Rabbit pAb

A16591-100ul 100 ul
EUR 308.00

RAB39B Rabbit pAb

A16591-200ul 200 ul
EUR 459.00

RAB39B Rabbit pAb

A16591-20ul 20 ul
EUR 183.00

RAB39B Rabbit pAb

A16591-50ul 50 ul
EUR 223.00

RAB39B Blocking Peptide

DF9829-BP 1mg
EUR 195.00

anti- RAB39B antibody

FNab07023 100µg
EUR 548.75
  • Immunogen: RAB39B, member RAS oncogene family
  • Uniprot ID: Q96DA2
  • Gene ID: 116442
  • Research Area: Signal Transduction
Description: Antibody raised against RAB39B

Anti-RAB39B antibody

STJ119030 100 µl
EUR 277.00

RAB39B protein (His tag)

80R-3956 100 ug
EUR 435.00
Description: Recombinant Human RAB39B protein

RAB39B Antibody, HRP conjugated

1-CSB-PA822194LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB39B Antibody, FITC conjugated

1-CSB-PA822194LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB39B Antibody, Biotin conjugated

1-CSB-PA822194LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB39B. Recognizes RAB39B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB39B ELISA KIT|Human

EF002239 96 Tests
EUR 689.00

Human RAB39B shRNA Plasmid

20-abx964514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB39B shRNA Plasmid

20-abx976322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB39B Recombinant Protein (Human)

RP025498 100 ug Ask for price

pECMV-3-FLAG-RAB39B

PVT12341 2 ug
EUR 703.00

RAB39B Recombinant Protein (Mouse)

RP166298 100 ug Ask for price

RAB39B Polyclonal Antibody, HRP Conjugated

A66283 100 µg
EUR 570.55
Description: reagents widely cited

RAB39B Polyclonal Antibody, FITC Conjugated

A66284 100 µg
EUR 570.55
Description: Ask the seller for details

RAB39B Polyclonal Antibody, Biotin Conjugated

A66285 100 µg
EUR 570.55
Description: The best epigenetics products

RAB39B ORF Vector (Human) (pORF)

ORF008500 1.0 ug DNA
EUR 95.00

Rab39b ORF Vector (Mouse) (pORF)

ORF055434 1.0 ug DNA
EUR 506.00

Rab39b sgRNA CRISPR Lentivector set (Mouse)

K3563201 3 x 1.0 ug
EUR 339.00

RAB39B sgRNA CRISPR Lentivector set (Human)

K1774301 3 x 1.0 ug
EUR 339.00

Rab39b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3563202 1.0 ug DNA
EUR 154.00

Rab39b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3563203 1.0 ug DNA
EUR 154.00

Rab39b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3563204 1.0 ug DNA
EUR 154.00

RAB39B sgRNA CRISPR Lentivector (Human) (Target 1)

K1774302 1.0 ug DNA
EUR 154.00

RAB39B sgRNA CRISPR Lentivector (Human) (Target 2)

K1774303 1.0 ug DNA
EUR 154.00

RAB39B sgRNA CRISPR Lentivector (Human) (Target 3)

K1774304 1.0 ug DNA
EUR 154.00

RAB39B Protein Vector (Mouse) (pPB-C-His)

PV221734 500 ng
EUR 603.00

RAB39B Protein Vector (Mouse) (pPB-N-His)

PV221735 500 ng
EUR 603.00

RAB39B Protein Vector (Mouse) (pPM-C-HA)

PV221736 500 ng
EUR 603.00

RAB39B Protein Vector (Mouse) (pPM-C-His)

PV221737 500 ng
EUR 603.00

RAB39B 3'UTR Luciferase Stable Cell Line

TU019394 1.0 ml
EUR 1521.00

Rab39b 3'UTR GFP Stable Cell Line

TU167420 1.0 ml Ask for price

RAB39B 3'UTR GFP Stable Cell Line

TU069394 1.0 ml
EUR 1521.00

Rab39b 3'UTR Luciferase Stable Cell Line

TU117420 1.0 ml Ask for price

RAB39B Protein Vector (Human) (pPB-C-His)

PV033997 500 ng
EUR 329.00

RAB39B Protein Vector (Human) (pPB-N-His)

PV033998 500 ng
EUR 329.00

RAB39B Protein Vector (Human) (pPM-C-HA)

PV033999 500 ng
EUR 329.00

RAB39B Protein Vector (Human) (pPM-C-His)

PV034000 500 ng
EUR 329.00

Monoclonal RAB39B Antibody (monoclonal) (M01), Clone: 1E12

AMM07475G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB39B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E12. This antibody is applicable in WB, E

Recombinant Human RAB39B Protein, His, E.coli-1mg

QP13240-1mg 1mg
EUR 3655.00

Recombinant Human RAB39B Protein, His, E.coli-20ug

QP13240-20ug 20ug
EUR 201.00

Recombinant Human RAB39B Protein, His, E.coli-5ug

QP13240-5ug 5ug
EUR 155.00

RAB39B, Member RAS Oncogene Family Human Recombinant Protein

PROTQ96DA2 Regular: 20ug
EUR 317.00
Description: RAB39B Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 236 amino acids (1-213 a.a) and having a molecular mass of 27kDa.;RAB39B is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Ras- related protein Rab- 39B, Rab39b ELISA KIT

ELI-22534m 96 Tests
EUR 865.00

Human Ras- related protein Rab- 39B, RAB39B ELISA KIT

ELI-18283h 96 Tests
EUR 824.00

Bovine Ras- related protein Rab- 39B, RAB39B ELISA KIT

ELI-42820b 96 Tests
EUR 928.00

Rab39b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3563205 3 x 1.0 ug
EUR 376.00