RAB7B

RAB7B Antibody

1-CSB-PA019220LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7B. Recognizes RAB7B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RAB7B antibody

70R-19723 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB7B antibody

RAB7B siRNA

20-abx930706
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB7B siRNA

20-abx930707
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAB7B

YF-PA22971 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB7B

anti-RAB7B

YF-PA22972 50 ug
EUR 363.00
Description: Mouse polyclonal to RAB7B

anti-RAB7B

YF-PA22973 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB7B

anti-RAB7B

YF-PA27030 50 ul
EUR 334.00
Description: Mouse polyclonal to RAB7B

RAB7B, Member RAS Oncogene Family (RAB7B) Antibody

abx031300-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

RAB7B, Member RAS Oncogene Family (RAB7B) Antibody

abx031300-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

RAB7B, Member RAS Oncogene Family (RAB7B) Antibody

abx237044-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB7B cloning plasmid

CSB-CL853383HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atggagccagcacgggaacaggggggcagcctagagcacaagctctatctgtgtccttcagagctcctgggaaacatgatgcgccctcatgggaatggcattttgcatatcacacaggctgtcctgggagtcaggcagactggattgtcacgtgcggtgtgcatgcagcagcttgt
  • Show more
Description: A cloning plasmid for the RAB7B gene.

RAB7B Polyclonal Antibody

30212-100ul 100ul
EUR 252.00

RAB7B Polyclonal Antibody

30212-50ul 50ul
EUR 187.00

Anti-RAB7B antibody

PAab07044 100 ug
EUR 355.00

anti-RAB7B (3B3)

LF-MA10271 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB7B

pCMV-SPORT6-RAB7B

PVT13301 2 ug
EUR 391.00

pCMV-SPORT6-RAB7B

PVT13517 2 ug
EUR 391.00

anti- RAB7B antibody

FNab07044 100µg
EUR 505.25
  • Immunogen: RAB7B, member RAS oncogene family
  • Uniprot ID: Q96AH8
  • Gene ID: 338382
  • Research Area: Signal Transduction
Description: Antibody raised against RAB7B

Anti-RAB7B (1C3)

YF-MA20104 50 ug
EUR 363.00
Description: Mouse monoclonal to RAB7B

Anti-RAB7B (1C3)

YF-MA20105 200 ul
EUR 363.00
Description: Mouse monoclonal to RAB7B

RAB7B Rabbit pAb

A17855-100ul 100 ul
EUR 308.00

RAB7B Rabbit pAb

A17855-200ul 200 ul
EUR 459.00

RAB7B Rabbit pAb

A17855-20ul 20 ul
EUR 183.00

RAB7B Rabbit pAb

A17855-50ul 50 ul
EUR 223.00

Anti-RAB7B antibody

STJ119868 100 µl
EUR 277.00

RAB7B Antibody, HRP conjugated

1-CSB-PA019220LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7B. Recognizes RAB7B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB7B Antibody, FITC conjugated

1-CSB-PA019220LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7B. Recognizes RAB7B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB7B Antibody, Biotin conjugated

1-CSB-PA019220LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7B. Recognizes RAB7B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RAB7B shRNA Plasmid

20-abx981489
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB7B shRNA Plasmid

20-abx967236
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB7B Polyclonal Conjugated Antibody

C30212 100ul
EUR 397.00

RAB7B ELISA KIT|Human

EF002259 96 Tests
EUR 689.00

RAB7B Recombinant Protein (Rat)

RP223388 100 ug Ask for price

RAB7B Recombinant Protein (Human)

RP025546 100 ug Ask for price

Rab7b ORF Vector (Rat) (pORF)

ORF074464 1.0 ug DNA
EUR 506.00

RAB7B ORF Vector (Human) (pORF)

ORF008516 1.0 ug DNA
EUR 95.00

Rab7B, Member Ras Oncogene Family Antibody

20-abx115001
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB7B sgRNA CRISPR Lentivector set (Human)

K1770101 3 x 1.0 ug
EUR 339.00

Rab7b sgRNA CRISPR Lentivector set (Rat)

K6377801 3 x 1.0 ug
EUR 339.00

RAB7B sgRNA CRISPR Lentivector (Human) (Target 1)

K1770102 1.0 ug DNA
EUR 154.00

RAB7B sgRNA CRISPR Lentivector (Human) (Target 2)

K1770103 1.0 ug DNA
EUR 154.00

RAB7B sgRNA CRISPR Lentivector (Human) (Target 3)

K1770104 1.0 ug DNA
EUR 154.00

Rab7b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6377802 1.0 ug DNA
EUR 154.00

Rab7b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6377803 1.0 ug DNA
EUR 154.00

Rab7b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6377804 1.0 ug DNA
EUR 154.00

RAB7B Protein Vector (Human) (pPB-C-His)

PV034061 500 ng
EUR 329.00

RAB7B Protein Vector (Human) (pPB-N-His)

PV034062 500 ng
EUR 329.00

RAB7B Protein Vector (Human) (pPM-C-HA)

PV034063 500 ng
EUR 329.00

RAB7B Protein Vector (Human) (pPM-C-His)

PV034064 500 ng
EUR 329.00

RAB7B 3'UTR Luciferase Stable Cell Line

TU019346 1.0 ml
EUR 2333.00

RAB7B Protein Vector (Rat) (pPB-C-His)

PV297854 500 ng
EUR 603.00

RAB7B Protein Vector (Rat) (pPB-N-His)

PV297855 500 ng
EUR 603.00

RAB7B Protein Vector (Rat) (pPM-C-HA)

PV297856 500 ng
EUR 603.00

RAB7B Protein Vector (Rat) (pPM-C-His)

PV297857 500 ng
EUR 603.00

RAB7B 3'UTR GFP Stable Cell Line

TU069346 1.0 ml
EUR 2333.00

Monoclonal RAB7B Antibody (monoclonal) (M01), Clone: 3B3

AMM07489G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB7B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B3. This antibody is applicable in WB, IP, E

Rab7b 3'UTR Luciferase Stable Cell Line

TU217222 1.0 ml Ask for price

Rab7b 3'UTR GFP Stable Cell Line

TU267222 1.0 ml Ask for price

Mouse Ras- related protein Rab- 7b, Rab7b ELISA KIT

ELI-36111m 96 Tests
EUR 865.00

Human Ras- related protein Rab- 7b, RAB7B ELISA KIT

ELI-18193h 96 Tests
EUR 824.00

Bovine Ras- related protein Rab- 7b, RAB7B ELISA KIT

ELI-14914b 96 Tests
EUR 928.00

RAB7B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1770105 3 x 1.0 ug
EUR 376.00

Rab7b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6377805 3 x 1.0 ug
EUR 376.00

RAB7B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1770106 1.0 ug DNA
EUR 167.00

RAB7B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1770107 1.0 ug DNA
EUR 167.00

RAB7B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1770108 1.0 ug DNA
EUR 167.00

Rab7b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6377806 1.0 ug DNA
EUR 167.00

Rab7b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6377807 1.0 ug DNA
EUR 167.00

Rab7b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6377808 1.0 ug DNA
EUR 167.00