RNF135

RNF135 Antibody

1-CSB-PA811599ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF135. Recognizes RNF135 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RNF135 Antibody

1-CSB-PA811599ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RNF135. Recognizes RNF135 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RNF135 siRNA

20-abx931685
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF135 siRNA

20-abx931686
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF135 siRNA

20-abx904604
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RNF135

YF-PA21365 50 ul
EUR 363.00
Description: Mouse polyclonal to RNF135

anti-RNF135

YF-PA21366 100 ug
EUR 403.00
Description: Rabbit polyclonal to RNF135

RNF135 cloning plasmid

CSB-CL811599HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1299
  • Sequence: atggcgggcctgggcctgggctccgccgttcccgtgtggctggccgaggacgacctcggctgcatcatctgccaggggctgctggactggcccgccacgctgccctgcggccacagcttctgccgccactgcctggaggccctgtggggcgcccgcgacgcccgccgctgggcct
  • Show more
Description: A cloning plasmid for the RNF135 gene.

Anti-RNF135 antibody

PAab07339 100 ug
EUR 412.00

pDONR223-RNF135 Plasmid

PVTB01189-1 2 ug
EUR 356.00

anti- RNF135 antibody

FNab07339 100µg
EUR 585.00
  • Immunogen: ring finger protein 135
  • Uniprot ID: Q8IUD6
  • Gene ID: 84282
  • Research Area: Epigenetics, Immunology, Metabolism
Description: Antibody raised against RNF135

Anti-RNF135 antibody

STJ111781 100 µl
EUR 277.00
Description: The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene is located in a chromosomal region known to be frequently deleted in patients with neurofibromatosis. Alternatively spliced transcript variants encoding distinct isoforms have been reported.

Mouse E3 ubiquitin- protein ligase RNF135, Rnf135 ELISA KIT

ELI-35794m 96 Tests
EUR 865.00

Human E3 ubiquitin- protein ligase RNF135, RNF135 ELISA KIT

ELI-52542h 96 Tests
EUR 824.00

Mouse RNF135 shRNA Plasmid

20-abx977599
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RNF135 shRNA Plasmid

20-abx989199
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNF135 shRNA Plasmid

20-abx963406
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNF135 ELISA KIT|Human

EF002506 96 Tests
EUR 689.00

RNF135 Recombinant Protein (Rat)

RP226316 100 ug Ask for price

RNF135 Recombinant Protein (Human)

RP042940 100 ug Ask for price

pCR4-TOPO-RNF135 Plasmid

PVTB01189-2 2 ug
EUR 356.00

RNF135 Recombinant Protein (Mouse)

RP168473 100 ug Ask for price

Rnf135 ORF Vector (Rat) (pORF)

ORF075440 1.0 ug DNA
EUR 506.00

RNF135 ORF Vector (Human) (pORF)

ORF014314 1.0 ug DNA
EUR 354.00

Rnf135 ORF Vector (Mouse) (pORF)

ORF056159 1.0 ug DNA
EUR 506.00

Polyclonal RNF135 Antibody(C-term)

APR13131G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RNF135 (C-term). This antibody is tested and proven to work in the following applications:

Ring Finger Protein 135 (RNF135) Antibody

abx030977-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ring Finger Protein 135 (RNF135) Antibody

abx030977-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ring Finger Protein 135 (RNF135) Antibody

20-abx123796
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 135 (RNF135) Antibody

abx122229-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RNF135 sgRNA CRISPR Lentivector set (Human)

K1838301 3 x 1.0 ug
EUR 339.00

Rnf135 sgRNA CRISPR Lentivector set (Mouse)

K4694201 3 x 1.0 ug
EUR 339.00

Ring Finger Protein 135 (RNF135) Antibody

20-abx321985
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 135 (RNF135) Antibody

20-abx321986
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 135 (RNF135) Antibody

abx237339-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Rnf135 sgRNA CRISPR Lentivector set (Rat)

K6212401 3 x 1.0 ug
EUR 339.00

RNF135 sgRNA CRISPR Lentivector (Human) (Target 1)

K1838302 1.0 ug DNA
EUR 154.00

RNF135 sgRNA CRISPR Lentivector (Human) (Target 2)

K1838303 1.0 ug DNA
EUR 154.00

RNF135 sgRNA CRISPR Lentivector (Human) (Target 3)

K1838304 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4694202 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4694203 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4694204 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6212402 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6212403 1.0 ug DNA
EUR 154.00

Rnf135 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6212404 1.0 ug DNA
EUR 154.00

RNF135 Protein Vector (Human) (pPB-C-His)

PV057253 500 ng
EUR 481.00

RNF135 Protein Vector (Human) (pPB-N-His)

PV057254 500 ng
EUR 481.00

RNF135 Protein Vector (Human) (pPM-C-HA)

PV057255 500 ng
EUR 481.00

RNF135 Protein Vector (Human) (pPM-C-His)

PV057256 500 ng
EUR 481.00

Rnf135 3'UTR GFP Stable Cell Line

TU167959 1.0 ml Ask for price

RNF135 Protein Vector (Mouse) (pPB-C-His)

PV224634 500 ng
EUR 603.00

RNF135 Protein Vector (Mouse) (pPB-N-His)

PV224635 500 ng
EUR 603.00

RNF135 Protein Vector (Mouse) (pPM-C-HA)

PV224636 500 ng
EUR 603.00

RNF135 Protein Vector (Mouse) (pPM-C-His)

PV224637 500 ng
EUR 603.00

RNF135 Protein Vector (Rat) (pPB-C-His)

PV301758 500 ng
EUR 603.00

RNF135 Protein Vector (Rat) (pPB-N-His)

PV301759 500 ng
EUR 603.00

RNF135 Protein Vector (Rat) (pPM-C-HA)

PV301760 500 ng
EUR 603.00

RNF135 Protein Vector (Rat) (pPM-C-His)

PV301761 500 ng
EUR 603.00

RNF135 3'UTR Luciferase Stable Cell Line

TU020067 1.0 ml
EUR 1394.00

RNF135 3'UTR GFP Stable Cell Line

TU070067 1.0 ml
EUR 1394.00

Rnf135 3'UTR Luciferase Stable Cell Line

TU117959 1.0 ml Ask for price

Rnf135 3'UTR Luciferase Stable Cell Line

TU219512 1.0 ml Ask for price

Rnf135 3'UTR GFP Stable Cell Line

TU269512 1.0 ml Ask for price

Human Ring Finger Protein 135 (RNF135) ELISA Kit

abx382843-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

RNF135 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663079 1.0 ug DNA
EUR 682.00

RNF135 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663083 1.0 ug DNA
EUR 682.00

RNF135 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663084 1.0 ug DNA
EUR 682.00

RNF135 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1838305 3 x 1.0 ug
EUR 376.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4694205 3 x 1.0 ug
EUR 376.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6212405 3 x 1.0 ug
EUR 376.00

RNF135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1838306 1.0 ug DNA
EUR 167.00

RNF135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1838307 1.0 ug DNA
EUR 167.00

RNF135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1838308 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4694206 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4694207 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4694208 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6212406 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6212407 1.0 ug DNA
EUR 167.00

Rnf135 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6212408 1.0 ug DNA
EUR 167.00

RNF135 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV663080 1.0 ug DNA
EUR 682.00

RNF135 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV663081 1.0 ug DNA
EUR 740.00

RNF135 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV663082 1.0 ug DNA
EUR 740.00