RTN4RL1

RTN4RL1 Antibody
1-CSB-PA803121LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RTN4RL1. Recognizes RTN4RL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
RTN4RL1 siRNA
20-abx932256
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4RL1 siRNA
20-abx932257
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4RL1 siRNA
20-abx904740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RTN4RL1 Polyclonal Antibody
27258-100ul 100ul
EUR 252.00
RTN4RL1 Polyclonal Antibody
27258-50ul 50ul
EUR 187.00
RTN4RL1 Polyclonal Antibody
A65990 100 µg
EUR 570.55
Description: kits suitable for this type of research
RTN4RL1 cloning plasmid
CSB-CL803121HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: ATGCTTCGCAAAGGGTGCTGTGTGGAGTTGCTGCTGCTGTTGGTAGCTGCGGAGCTGCCCCTGGGTGGTGGCTGCCCACGGGACTGTGTGTGCTACCCGGCGCCCATGACGGTCAGCTGCCAGGCGCACAACTTTGCAGCCATCCCGGAGGGCATCCCCGTGGACAGCGAGCGCG
  • Show more
Description: A cloning plasmid for the RTN4RL1 gene.
RTN4RL1 Antibody (HRP)
20-abx308458
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RTN4RL1 Antibody (FITC)
20-abx308459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RTN4RL1 Antibody (Biotin)
20-abx308460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RTN4RL1 Rabbit pAb
A10021-100ul 100 ul
EUR 308.00
RTN4RL1 Rabbit pAb
A10021-200ul 200 ul
EUR 459.00
RTN4RL1 Rabbit pAb
A10021-20ul 20 ul
EUR 183.00
RTN4RL1 Rabbit pAb
A10021-50ul 50 ul
EUR 223.00
Anti-RTN4RL1 antibody
STJ112061 100 µl
EUR 277.00
RTN4RL1 Antibody, HRP conjugated
1-CSB-PA803121LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RTN4RL1. Recognizes RTN4RL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RTN4RL1 Antibody, FITC conjugated
1-CSB-PA803121LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RTN4RL1. Recognizes RTN4RL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RTN4RL1 Antibody, Biotin conjugated
1-CSB-PA803121LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RTN4RL1. Recognizes RTN4RL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse RTN4RL1 shRNA Plasmid
20-abx982308
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RTN4RL1 shRNA Plasmid
20-abx989192
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RTN4RL1 shRNA Plasmid
20-abx965488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RTN4RL1 Polyclonal Conjugated Antibody
C27258 100ul
EUR 397.00
RTN4RL1 Recombinant Protein (Rat)
RP227243 100 ug Ask for price
RTN4RL1 Recombinant Protein (Human)
RP043054 100 ug Ask for price
RTN4RL1 Recombinant Protein (Mouse)
RP169607 100 ug Ask for price
RTN4RL1 Polyclonal Antibody, HRP Conjugated
A65991 100 µg
EUR 570.55
Description: fast delivery possible
RTN4RL1 Polyclonal Antibody, FITC Conjugated
A65992 100 µg
EUR 570.55
Description: reagents widely cited
RTN4RL1 Polyclonal Antibody, Biotin Conjugated
A65993 100 µg
EUR 570.55
Description: Ask the seller for details
Rtn4rl1 ORF Vector (Rat) (pORF)
ORF075749 1.0 ug DNA
EUR 506.00
RTN4RL1 ORF Vector (Human) (pORF)
ORF014352 1.0 ug DNA
EUR 354.00
Rtn4rl1 ORF Vector (Mouse) (pORF)
ORF056537 1.0 ug DNA
EUR 506.00
Polyclonal RTN4RL1 Antibody - middle region
APR13166G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RTN4RL1 - middle region. This antibody is tested and proven to work in the following applications:
RTN4RL1 sgRNA CRISPR Lentivector set (Human)
K2076901 3 x 1.0 ug
EUR 339.00
Rtn4rl1 sgRNA CRISPR Lentivector set (Mouse)
K4511701 3 x 1.0 ug
EUR 339.00
Rtn4rl1 sgRNA CRISPR Lentivector set (Rat)
K7307401 3 x 1.0 ug
EUR 339.00
Polyclonal RTN4RL1 Antibody - C-terminal region
APR13165G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RTN4RL1 - C-terminal region. This antibody is tested and proven to work in the following applications:
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx032462-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx135939
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
abx122324-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
RTN4RL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2076902 1.0 ug DNA
EUR 154.00
RTN4RL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2076903 1.0 ug DNA
EUR 154.00
RTN4RL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2076904 1.0 ug DNA
EUR 154.00
Rtn4rl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4511702 1.0 ug DNA
EUR 154.00
Rtn4rl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4511703 1.0 ug DNA
EUR 154.00
Rtn4rl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4511704 1.0 ug DNA
EUR 154.00
Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody
20-abx308457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rtn4rl1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7307402 1.0 ug DNA
EUR 154.00
Rtn4rl1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7307403 1.0 ug DNA
EUR 154.00
Rtn4rl1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7307404 1.0 ug DNA
EUR 154.00
RTN4RL1 Protein Vector (Human) (pPB-C-His)
PV057405 500 ng
EUR 481.00
RTN4RL1 Protein Vector (Human) (pPB-N-His)
PV057406 500 ng
EUR 481.00
RTN4RL1 Protein Vector (Human) (pPM-C-HA)
PV057407 500 ng
EUR 481.00
RTN4RL1 Protein Vector (Human) (pPM-C-His)
PV057408 500 ng
EUR 481.00
Rtn4rl1 3'UTR GFP Stable Cell Line
TU168246 1.0 ml Ask for price
RTN4RL1 Protein Vector (Mouse) (pPB-C-His)
PV226146 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Mouse) (pPB-N-His)
PV226147 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Mouse) (pPM-C-HA)
PV226148 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Mouse) (pPM-C-His)
PV226149 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Rat) (pPB-C-His)
PV302994 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Rat) (pPB-N-His)
PV302995 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Rat) (pPM-C-HA)
PV302996 500 ng
EUR 603.00
RTN4RL1 Protein Vector (Rat) (pPM-C-His)
PV302997 500 ng
EUR 603.00
RTN4RL1 3'UTR Luciferase Stable Cell Line
TU022464 1.0 ml
EUR 1521.00
RTN4RL1 3'UTR GFP Stable Cell Line
TU072464 1.0 ml
EUR 1521.00
Rtn4rl1 3'UTR Luciferase Stable Cell Line
TU118246 1.0 ml Ask for price
Rtn4rl1 3'UTR Luciferase Stable Cell Line
TU219832 1.0 ml Ask for price
Rtn4rl1 3'UTR GFP Stable Cell Line
TU269832 1.0 ml Ask for price
RTN4RL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666559 1.0 ug DNA
EUR 682.00
RTN4RL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666563 1.0 ug DNA
EUR 682.00
RTN4RL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666564 1.0 ug DNA
EUR 682.00
Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT
ELI-35842h 96 Tests
EUR 824.00
Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT
ELI-52476m 96 Tests
EUR 865.00
RTN4RL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2076905 3 x 1.0 ug
EUR 376.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4511705 3 x 1.0 ug
EUR 376.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7307405 3 x 1.0 ug
EUR 376.00
RTN4RL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2076906 1.0 ug DNA
EUR 167.00
RTN4RL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2076907 1.0 ug DNA
EUR 167.00
RTN4RL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2076908 1.0 ug DNA
EUR 167.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4511706 1.0 ug DNA
EUR 167.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4511707 1.0 ug DNA
EUR 167.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4511708 1.0 ug DNA
EUR 167.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7307406 1.0 ug DNA
EUR 167.00
Rtn4rl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7307407 1.0 ug DNA
EUR 167.00