SEC22C

SEC22C siRNA
20-abx932769
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEC22C antibody
70R-6302 50 ug
EUR 467.00
Description: Rabbit polyclonal SEC22C antibody
anti-SEC22C
YF-PA25266 50 ul
EUR 334.00
Description: Mouse polyclonal to SEC22C
Bovine Vesicle- trafficking protein SEC22c, SEC22C ELISA KIT
ELI-15489b 96 Tests
EUR 928.00
Human Vesicle- trafficking protein SEC22c, SEC22C ELISA KIT
ELI-53031h 96 Tests
EUR 824.00
Mouse Vesicle- trafficking protein SEC22c, Sec22c ELISA KIT
ELI-45440m 96 Tests
EUR 865.00
SEC22C Blocking Peptide
33R-3053 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC22C antibody, catalog no. 70R-6302
SEC22C cloning plasmid
CSB-CL883585HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 912
  • Sequence: atgtccgtgatcttttttgcctgcgtggtacgggtaagggatggactgcccctctcagcctctactgatttttaccacacccaagattttttggaatggaggagacggctcaagagtttagccttgcgactggcccagtatccaggtcgaggttctgcagaaggttgtgactttag
  • Show more
Description: A cloning plasmid for the SEC22C gene.
SEC22C cloning plasmid
CSB-CL883585HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgtccgtgatcttttttgcctgcgtggtacgggtaagggatggactgcccctctcagcctctactgatttttaccacacccaagattttttggaatggaggagacggctcaagagtttagccttgcgactggcccagtatccaggtcgaggttctgcagaaggttgtgactttag
  • Show more
Description: A cloning plasmid for the SEC22C gene.
Human SEC22C shRNA Plasmid
20-abx956024
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SEC22C shRNA Plasmid
20-abx980935
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEC22C Recombinant Protein (Human)
RP027892 100 ug Ask for price
SEC22C Recombinant Protein (Human)
RP027895 100 ug Ask for price
SEC22C Recombinant Protein (Mouse)
RP170543 100 ug Ask for price
SEC22C Recombinant Protein (Mouse)
RP170546 100 ug Ask for price
SEC22C ORF Vector (Human) (pORF)
ORF009298 1.0 ug DNA
EUR 95.00
SEC22C ORF Vector (Human) (pORF)
ORF009299 1.0 ug DNA
EUR 95.00
Sec22c ORF Vector (Mouse) (pORF)
ORF056849 1.0 ug DNA
EUR 506.00
Sec22c ORF Vector (Mouse) (pORF)
ORF056850 1.0 ug DNA
EUR 506.00
Polyclonal SEC22C antibody - middle region
AMM07740G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC22C - middle region. This antibody is tested and proven to work in the following applications:
Sec22c sgRNA CRISPR Lentivector set (Mouse)
K4508501 3 x 1.0 ug
EUR 339.00
SEC22C sgRNA CRISPR Lentivector set (Human)
K2113101 3 x 1.0 ug
EUR 339.00
Sec22c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4508502 1.0 ug DNA
EUR 154.00
Sec22c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4508503 1.0 ug DNA
EUR 154.00
Sec22c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4508504 1.0 ug DNA
EUR 154.00
SEC22C Protein Vector (Human) (pPB-C-His)
PV037189 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPB-N-His)
PV037190 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPM-C-HA)
PV037191 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPM-C-His)
PV037192 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPB-C-His)
PV037193 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPB-N-His)
PV037194 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPM-C-HA)
PV037195 500 ng
EUR 329.00
SEC22C Protein Vector (Human) (pPM-C-His)
PV037196 500 ng
EUR 329.00
SEC22C 3'UTR Luciferase Stable Cell Line
TU022834 1.0 ml
EUR 4617.00
SEC22C sgRNA CRISPR Lentivector (Human) (Target 1)
K2113102 1.0 ug DNA
EUR 154.00
SEC22C sgRNA CRISPR Lentivector (Human) (Target 2)
K2113103 1.0 ug DNA
EUR 154.00
SEC22C sgRNA CRISPR Lentivector (Human) (Target 3)
K2113104 1.0 ug DNA
EUR 154.00
Sec22c 3'UTR GFP Stable Cell Line
TU168496 1.0 ml Ask for price
SEC22C 3'UTR GFP Stable Cell Line
TU072834 1.0 ml
EUR 4617.00
Sec22c 3'UTR Luciferase Stable Cell Line
TU118496 1.0 ml Ask for price
SEC22C Protein Vector (Mouse) (pPB-C-His)
PV227394 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPB-N-His)
PV227395 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPM-C-HA)
PV227396 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPM-C-His)
PV227397 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPB-C-His)
PV227398 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPB-N-His)
PV227399 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPM-C-HA)
PV227400 500 ng
EUR 603.00
SEC22C Protein Vector (Mouse) (pPM-C-His)
PV227401 500 ng
EUR 603.00
SEC22C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV714855 1.0 ug DNA
EUR 316.00
SEC22C Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV714859 1.0 ug DNA
EUR 316.00
SEC22C Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV714860 1.0 ug DNA
EUR 316.00
Sec22c sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4508505 3 x 1.0 ug
EUR 376.00
SEC22C sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113105 3 x 1.0 ug
EUR 376.00
Sec22c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4508506 1.0 ug DNA
EUR 167.00
Sec22c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4508507 1.0 ug DNA
EUR 167.00
Sec22c sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4508508 1.0 ug DNA
EUR 167.00
SEC22C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2113106 1.0 ug DNA
EUR 167.00
SEC22C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2113107 1.0 ug DNA
EUR 167.00
SEC22C sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2113108 1.0 ug DNA
EUR 167.00
SEC22C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV714856 1.0 ug DNA
EUR 316.00
SEC22C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV714857 1.0 ug DNA
EUR 374.00
SEC22C Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV714858 1.0 ug DNA
EUR 374.00