SEH1L

SEH1L siRNA
20-abx932801
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEH1L cloning plasmid
CSB-CL856924HU-10ug 10ug
EUR 413.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgtttgtggctcgcagcatcgcggcggaccacaaggatctcatccacgatgtctctttcgacttccacgggcggcggatggcaacctgctccagcgatcagagcgttaaggtctgggataaaagtgaaagtggtgattggcattgtactgctagctggaagacacatagtggat
  • Show more
Description: A cloning plasmid for the SEH1L gene.
Mouse SEH1L shRNA Plasmid
20-abx977680
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SEH1L shRNA Plasmid
20-abx963084
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEH1L Recombinant Protein (Human)
RP027946 100 ug Ask for price
SEH1L Recombinant Protein (Mouse)
RP170624 100 ug Ask for price
SEH1L Recombinant Protein (Mouse)
RP170627 100 ug Ask for price
SEH1L ORF Vector (Human) (pORF)
ORF009316 1.0 ug DNA
EUR 95.00
Seh1l ORF Vector (Mouse) (pORF)
ORF056876 1.0 ug DNA
EUR 506.00
Seh1l ORF Vector (Mouse) (pORF)
ORF056877 1.0 ug DNA
EUR 506.00
SEH1L sgRNA CRISPR Lentivector set (Human)
K2115001 3 x 1.0 ug
EUR 339.00
Seh1l sgRNA CRISPR Lentivector set (Mouse)
K4877601 3 x 1.0 ug
EUR 339.00
Human Nucleoporin SEH1, SEH1L ELISA KIT
ELI-52449h 96 Tests
EUR 824.00
Mouse Nucleoporin SEH1, Seh1l ELISA KIT
ELI-29665m 96 Tests
EUR 865.00
Bovine Nucleoporin SEH1, SEH1L ELISA KIT
ELI-30413b 96 Tests
EUR 928.00
SEH1L sgRNA CRISPR Lentivector (Human) (Target 1)
K2115002 1.0 ug DNA
EUR 154.00
SEH1L sgRNA CRISPR Lentivector (Human) (Target 2)
K2115003 1.0 ug DNA
EUR 154.00
SEH1L sgRNA CRISPR Lentivector (Human) (Target 3)
K2115004 1.0 ug DNA
EUR 154.00
Seh1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4877602 1.0 ug DNA
EUR 154.00
Seh1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4877603 1.0 ug DNA
EUR 154.00
Seh1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4877604 1.0 ug DNA
EUR 154.00
SEH1L Protein Vector (Human) (pPB-C-His)
PV037261 500 ng
EUR 329.00
SEH1L Protein Vector (Human) (pPB-N-His)
PV037262 500 ng
EUR 329.00
SEH1L Protein Vector (Human) (pPM-C-HA)
PV037263 500 ng
EUR 329.00
SEH1L Protein Vector (Human) (pPM-C-His)
PV037264 500 ng
EUR 329.00
Seh1l 3'UTR GFP Stable Cell Line
TU168516 1.0 ml Ask for price
SEH1L Protein Vector (Mouse) (pPB-C-His)
PV227502 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPB-N-His)
PV227503 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPM-C-HA)
PV227504 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPM-C-His)
PV227505 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPB-C-His)
PV227506 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPB-N-His)
PV227507 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPM-C-HA)
PV227508 500 ng
EUR 603.00
SEH1L Protein Vector (Mouse) (pPM-C-His)
PV227509 500 ng
EUR 603.00
SEH1L 3'UTR Luciferase Stable Cell Line
TU022853 1.0 ml
EUR 1521.00
SEH1L 3'UTR GFP Stable Cell Line
TU072853 1.0 ml
EUR 1521.00
Seh1l 3'UTR Luciferase Stable Cell Line
TU118516 1.0 ml Ask for price
Recombinant Saccharomyces Cerevisiae SEH1L Protein (aa 1-349) [His]
VAng-Wyb5749-1mg 1 mg
EUR 4598.00
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) (Bakers yeast) SEH1-Like protein, recombinant protein.
SEH1L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2115005 3 x 1.0 ug
EUR 376.00
Seh1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4877605 3 x 1.0 ug
EUR 376.00
SEH1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2115006 1.0 ug DNA
EUR 167.00
SEH1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2115007 1.0 ug DNA
EUR 167.00
SEH1L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2115008 1.0 ug DNA
EUR 167.00
Seh1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4877606 1.0 ug DNA
EUR 167.00
Seh1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4877607 1.0 ug DNA
EUR 167.00
Seh1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4877608 1.0 ug DNA
EUR 167.00